ID: 1091883527

View in Genome Browser
Species Human (GRCh38)
Location 12:3999366-3999388
Sequence CCTGGCCACATGGTGGGATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091883527_1091883537 -4 Left 1091883527 12:3999366-3999388 CCTAATCCCACCATGTGGCCAGG No data
Right 1091883537 12:3999385-3999407 CAGGGTTAAGGGTAGGAGCCAGG No data
1091883527_1091883538 0 Left 1091883527 12:3999366-3999388 CCTAATCCCACCATGTGGCCAGG No data
Right 1091883538 12:3999389-3999411 GTTAAGGGTAGGAGCCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091883527 Original CRISPR CCTGGCCACATGGTGGGATT AGG (reversed) Intergenic
No off target data available for this crispr