ID: 1091885372

View in Genome Browser
Species Human (GRCh38)
Location 12:4013396-4013418
Sequence TTGGAGTAGCTGCATGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091885372_1091885377 7 Left 1091885372 12:4013396-4013418 CCATCTCCATGCAGCTACTCCAA No data
Right 1091885377 12:4013426-4013448 AGCCAGCCACGGAGCACTCCTGG No data
1091885372_1091885380 20 Left 1091885372 12:4013396-4013418 CCATCTCCATGCAGCTACTCCAA No data
Right 1091885380 12:4013439-4013461 GCACTCCTGGAACTCTTTGCAGG No data
1091885372_1091885375 -4 Left 1091885372 12:4013396-4013418 CCATCTCCATGCAGCTACTCCAA No data
Right 1091885375 12:4013415-4013437 CCAAGCTCCAGAGCCAGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091885372 Original CRISPR TTGGAGTAGCTGCATGGAGA TGG (reversed) Intergenic
No off target data available for this crispr