ID: 1091887344

View in Genome Browser
Species Human (GRCh38)
Location 12:4026174-4026196
Sequence TAAAGCATTGACGCCGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091887344_1091887347 16 Left 1091887344 12:4026174-4026196 CCTGGCACGGCGTCAATGCTTTA No data
Right 1091887347 12:4026213-4026235 TCTTTGTAGATGAAGAAACTGGG 0: 1
1: 2
2: 14
3: 124
4: 726
1091887344_1091887346 15 Left 1091887344 12:4026174-4026196 CCTGGCACGGCGTCAATGCTTTA No data
Right 1091887346 12:4026212-4026234 ATCTTTGTAGATGAAGAAACTGG 0: 1
1: 0
2: 14
3: 90
4: 628
1091887344_1091887348 17 Left 1091887344 12:4026174-4026196 CCTGGCACGGCGTCAATGCTTTA No data
Right 1091887348 12:4026214-4026236 CTTTGTAGATGAAGAAACTGGGG No data
1091887344_1091887349 27 Left 1091887344 12:4026174-4026196 CCTGGCACGGCGTCAATGCTTTA No data
Right 1091887349 12:4026224-4026246 GAAGAAACTGGGGCTCTGAATGG 0: 1
1: 3
2: 64
3: 469
4: 2456

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091887344 Original CRISPR TAAAGCATTGACGCCGTGCC AGG (reversed) Intergenic
No off target data available for this crispr