ID: 1091888891

View in Genome Browser
Species Human (GRCh38)
Location 12:4037069-4037091
Sequence AAGAGCTATCACATGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091888891_1091888895 28 Left 1091888891 12:4037069-4037091 CCCTCTTCCATGTGATAGCTCTT No data
Right 1091888895 12:4037120-4037142 TTCTTAGTCTTTTCATGCTGAGG No data
1091888891_1091888894 -9 Left 1091888891 12:4037069-4037091 CCCTCTTCCATGTGATAGCTCTT No data
Right 1091888894 12:4037083-4037105 ATAGCTCTTCAAATATTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091888891 Original CRISPR AAGAGCTATCACATGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr