ID: 1091891230

View in Genome Browser
Species Human (GRCh38)
Location 12:4056201-4056223
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091891230_1091891238 9 Left 1091891230 12:4056201-4056223 CCAGCCACAGCCAAAACTAGCCC No data
Right 1091891238 12:4056233-4056255 GCCATGGAGGATCTCTGATCTGG No data
1091891230_1091891233 -7 Left 1091891230 12:4056201-4056223 CCAGCCACAGCCAAAACTAGCCC No data
Right 1091891233 12:4056217-4056239 CTAGCCCCTATCAGCAGCCATGG No data
1091891230_1091891234 -4 Left 1091891230 12:4056201-4056223 CCAGCCACAGCCAAAACTAGCCC No data
Right 1091891234 12:4056220-4056242 GCCCCTATCAGCAGCCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091891230 Original CRISPR GGGCTAGTTTTGGCTGTGGC TGG (reversed) Intergenic
No off target data available for this crispr