ID: 1091891233

View in Genome Browser
Species Human (GRCh38)
Location 12:4056217-4056239
Sequence CTAGCCCCTATCAGCAGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091891229_1091891233 10 Left 1091891229 12:4056184-4056206 CCAATGGGACATGTTGTCCAGCC No data
Right 1091891233 12:4056217-4056239 CTAGCCCCTATCAGCAGCCATGG No data
1091891228_1091891233 20 Left 1091891228 12:4056174-4056196 CCTTCGTTTGCCAATGGGACATG No data
Right 1091891233 12:4056217-4056239 CTAGCCCCTATCAGCAGCCATGG No data
1091891230_1091891233 -7 Left 1091891230 12:4056201-4056223 CCAGCCACAGCCAAAACTAGCCC No data
Right 1091891233 12:4056217-4056239 CTAGCCCCTATCAGCAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091891233 Original CRISPR CTAGCCCCTATCAGCAGCCA TGG Intergenic
No off target data available for this crispr