ID: 1091891238

View in Genome Browser
Species Human (GRCh38)
Location 12:4056233-4056255
Sequence GCCATGGAGGATCTCTGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091891231_1091891238 5 Left 1091891231 12:4056205-4056227 CCACAGCCAAAACTAGCCCCTAT No data
Right 1091891238 12:4056233-4056255 GCCATGGAGGATCTCTGATCTGG No data
1091891230_1091891238 9 Left 1091891230 12:4056201-4056223 CCAGCCACAGCCAAAACTAGCCC No data
Right 1091891238 12:4056233-4056255 GCCATGGAGGATCTCTGATCTGG No data
1091891232_1091891238 -1 Left 1091891232 12:4056211-4056233 CCAAAACTAGCCCCTATCAGCAG No data
Right 1091891238 12:4056233-4056255 GCCATGGAGGATCTCTGATCTGG No data
1091891229_1091891238 26 Left 1091891229 12:4056184-4056206 CCAATGGGACATGTTGTCCAGCC No data
Right 1091891238 12:4056233-4056255 GCCATGGAGGATCTCTGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091891238 Original CRISPR GCCATGGAGGATCTCTGATC TGG Intergenic
No off target data available for this crispr