ID: 1091894619

View in Genome Browser
Species Human (GRCh38)
Location 12:4091195-4091217
Sequence TCTCTGGGAACCCCCTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091894619_1091894624 0 Left 1091894619 12:4091195-4091217 CCTCCAGAGGGGGTTCCCAGAGA No data
Right 1091894624 12:4091218-4091240 CAGGAAGCGTGAAGCAATCAAGG No data
1091894619_1091894625 10 Left 1091894619 12:4091195-4091217 CCTCCAGAGGGGGTTCCCAGAGA No data
Right 1091894625 12:4091228-4091250 GAAGCAATCAAGGAAGAGCCTGG No data
1091894619_1091894626 16 Left 1091894619 12:4091195-4091217 CCTCCAGAGGGGGTTCCCAGAGA No data
Right 1091894626 12:4091234-4091256 ATCAAGGAAGAGCCTGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091894619 Original CRISPR TCTCTGGGAACCCCCTCTGG AGG (reversed) Intergenic
No off target data available for this crispr