ID: 1091894624

View in Genome Browser
Species Human (GRCh38)
Location 12:4091218-4091240
Sequence CAGGAAGCGTGAAGCAATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091894614_1091894624 12 Left 1091894614 12:4091183-4091205 CCTGGTGGACTCCCTCCAGAGGG No data
Right 1091894624 12:4091218-4091240 CAGGAAGCGTGAAGCAATCAAGG No data
1091894611_1091894624 29 Left 1091894611 12:4091166-4091188 CCAGAAATTAGAAAGTGCCTGGT No data
Right 1091894624 12:4091218-4091240 CAGGAAGCGTGAAGCAATCAAGG No data
1091894618_1091894624 1 Left 1091894618 12:4091194-4091216 CCCTCCAGAGGGGGTTCCCAGAG No data
Right 1091894624 12:4091218-4091240 CAGGAAGCGTGAAGCAATCAAGG No data
1091894620_1091894624 -3 Left 1091894620 12:4091198-4091220 CCAGAGGGGGTTCCCAGAGACAG No data
Right 1091894624 12:4091218-4091240 CAGGAAGCGTGAAGCAATCAAGG No data
1091894619_1091894624 0 Left 1091894619 12:4091195-4091217 CCTCCAGAGGGGGTTCCCAGAGA No data
Right 1091894624 12:4091218-4091240 CAGGAAGCGTGAAGCAATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091894624 Original CRISPR CAGGAAGCGTGAAGCAATCA AGG Intergenic