ID: 1091894625

View in Genome Browser
Species Human (GRCh38)
Location 12:4091228-4091250
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091894622_1091894625 -5 Left 1091894622 12:4091210-4091232 CCCAGAGACAGGAAGCGTGAAGC No data
Right 1091894625 12:4091228-4091250 GAAGCAATCAAGGAAGAGCCTGG No data
1091894618_1091894625 11 Left 1091894618 12:4091194-4091216 CCCTCCAGAGGGGGTTCCCAGAG No data
Right 1091894625 12:4091228-4091250 GAAGCAATCAAGGAAGAGCCTGG No data
1091894620_1091894625 7 Left 1091894620 12:4091198-4091220 CCAGAGGGGGTTCCCAGAGACAG No data
Right 1091894625 12:4091228-4091250 GAAGCAATCAAGGAAGAGCCTGG No data
1091894619_1091894625 10 Left 1091894619 12:4091195-4091217 CCTCCAGAGGGGGTTCCCAGAGA No data
Right 1091894625 12:4091228-4091250 GAAGCAATCAAGGAAGAGCCTGG No data
1091894623_1091894625 -6 Left 1091894623 12:4091211-4091233 CCAGAGACAGGAAGCGTGAAGCA No data
Right 1091894625 12:4091228-4091250 GAAGCAATCAAGGAAGAGCCTGG No data
1091894614_1091894625 22 Left 1091894614 12:4091183-4091205 CCTGGTGGACTCCCTCCAGAGGG No data
Right 1091894625 12:4091228-4091250 GAAGCAATCAAGGAAGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091894625 Original CRISPR GAAGCAATCAAGGAAGAGCC TGG Intergenic