ID: 1091903790

View in Genome Browser
Species Human (GRCh38)
Location 12:4166074-4166096
Sequence GTGTGTGTGTGCAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091903790_1091903799 23 Left 1091903790 12:4166074-4166096 CCCTCTTCCCTGCACACACACAC No data
Right 1091903799 12:4166120-4166142 TAGCTGACTCCTCACCTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091903790 Original CRISPR GTGTGTGTGTGCAGGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr