ID: 1091913664

View in Genome Browser
Species Human (GRCh38)
Location 12:4251874-4251896
Sequence ACTCATTAGAGATCTAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091913662_1091913664 1 Left 1091913662 12:4251850-4251872 CCTGGCTGAAAAAATAATGACCA No data
Right 1091913664 12:4251874-4251896 ACTCATTAGAGATCTAAGACAGG No data
1091913661_1091913664 2 Left 1091913661 12:4251849-4251871 CCCTGGCTGAAAAAATAATGACC No data
Right 1091913664 12:4251874-4251896 ACTCATTAGAGATCTAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091913664 Original CRISPR ACTCATTAGAGATCTAAGAC AGG Intergenic
No off target data available for this crispr