ID: 1091914354

View in Genome Browser
Species Human (GRCh38)
Location 12:4258167-4258189
Sequence AAAGCAAATAAGTTTAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091914354_1091914355 12 Left 1091914354 12:4258167-4258189 CCATCTTTAAACTTATTTGCTTT No data
Right 1091914355 12:4258202-4258224 TCTTACAGACAGCATATAGTTGG 0: 4
1: 39
2: 263
3: 939
4: 2932

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091914354 Original CRISPR AAAGCAAATAAGTTTAAAGA TGG (reversed) Intergenic
No off target data available for this crispr