ID: 1091914355

View in Genome Browser
Species Human (GRCh38)
Location 12:4258202-4258224
Sequence TCTTACAGACAGCATATAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4177
Summary {0: 4, 1: 39, 2: 263, 3: 939, 4: 2932}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091914354_1091914355 12 Left 1091914354 12:4258167-4258189 CCATCTTTAAACTTATTTGCTTT No data
Right 1091914355 12:4258202-4258224 TCTTACAGACAGCATATAGTTGG 0: 4
1: 39
2: 263
3: 939
4: 2932

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091914355 Original CRISPR TCTTACAGACAGCATATAGT TGG Intergenic
Too many off-targets to display for this crispr