ID: 1091916085

View in Genome Browser
Species Human (GRCh38)
Location 12:4272621-4272643
Sequence GAAGTCGCCGCCAGCACGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 28
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 25}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091916085_1091916088 -4 Left 1091916085 12:4272621-4272643 CCGACCGTGCTGGCGGCGACTTC 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1091916088 12:4272640-4272662 CTTCACCGCAGTCGGCTCCCAGG 0: 1
1: 0
2: 0
3: 2
4: 79
1091916085_1091916096 28 Left 1091916085 12:4272621-4272643 CCGACCGTGCTGGCGGCGACTTC 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1091916096 12:4272672-4272694 TGGCGAGTGAGGCGCGAAACCGG 0: 1
1: 0
2: 0
3: 2
4: 25
1091916085_1091916094 17 Left 1091916085 12:4272621-4272643 CCGACCGTGCTGGCGGCGACTTC 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1091916094 12:4272661-4272683 GGGAGAAAGCCTGGCGAGTGAGG 0: 1
1: 0
2: 2
3: 32
4: 263
1091916085_1091916091 8 Left 1091916085 12:4272621-4272643 CCGACCGTGCTGGCGGCGACTTC 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1091916091 12:4272652-4272674 CGGCTCCCAGGGAGAAAGCCTGG 0: 1
1: 0
2: 2
3: 18
4: 241
1091916085_1091916089 -3 Left 1091916085 12:4272621-4272643 CCGACCGTGCTGGCGGCGACTTC 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1091916089 12:4272641-4272663 TTCACCGCAGTCGGCTCCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091916085 Original CRISPR GAAGTCGCCGCCAGCACGGT CGG (reversed) Intergenic