ID: 1091916086

View in Genome Browser
Species Human (GRCh38)
Location 12:4272625-4272647
Sequence CGGTGAAGTCGCCGCCAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 26}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091916086_1091916098 28 Left 1091916086 12:4272625-4272647 CCGTGCTGGCGGCGACTTCACCG 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1091916098 12:4272676-4272698 GAGTGAGGCGCGAAACCGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 69
1091916086_1091916096 24 Left 1091916086 12:4272625-4272647 CCGTGCTGGCGGCGACTTCACCG 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1091916096 12:4272672-4272694 TGGCGAGTGAGGCGCGAAACCGG 0: 1
1: 0
2: 0
3: 2
4: 25
1091916086_1091916089 -7 Left 1091916086 12:4272625-4272647 CCGTGCTGGCGGCGACTTCACCG 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1091916089 12:4272641-4272663 TTCACCGCAGTCGGCTCCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 39
1091916086_1091916091 4 Left 1091916086 12:4272625-4272647 CCGTGCTGGCGGCGACTTCACCG 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1091916091 12:4272652-4272674 CGGCTCCCAGGGAGAAAGCCTGG 0: 1
1: 0
2: 2
3: 18
4: 241
1091916086_1091916094 13 Left 1091916086 12:4272625-4272647 CCGTGCTGGCGGCGACTTCACCG 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1091916094 12:4272661-4272683 GGGAGAAAGCCTGGCGAGTGAGG 0: 1
1: 0
2: 2
3: 32
4: 263
1091916086_1091916088 -8 Left 1091916086 12:4272625-4272647 CCGTGCTGGCGGCGACTTCACCG 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1091916088 12:4272640-4272662 CTTCACCGCAGTCGGCTCCCAGG 0: 1
1: 0
2: 0
3: 2
4: 79
1091916086_1091916099 29 Left 1091916086 12:4272625-4272647 CCGTGCTGGCGGCGACTTCACCG 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1091916099 12:4272677-4272699 AGTGAGGCGCGAAACCGGAGGGG 0: 1
1: 0
2: 0
3: 1
4: 25
1091916086_1091916097 27 Left 1091916086 12:4272625-4272647 CCGTGCTGGCGGCGACTTCACCG 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1091916097 12:4272675-4272697 CGAGTGAGGCGCGAAACCGGAGG 0: 1
1: 0
2: 0
3: 1
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091916086 Original CRISPR CGGTGAAGTCGCCGCCAGCA CGG (reversed) Intergenic