ID: 1091916089

View in Genome Browser
Species Human (GRCh38)
Location 12:4272641-4272663
Sequence TTCACCGCAGTCGGCTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 39}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091916086_1091916089 -7 Left 1091916086 12:4272625-4272647 CCGTGCTGGCGGCGACTTCACCG 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1091916089 12:4272641-4272663 TTCACCGCAGTCGGCTCCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 39
1091916085_1091916089 -3 Left 1091916085 12:4272621-4272643 CCGACCGTGCTGGCGGCGACTTC 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1091916089 12:4272641-4272663 TTCACCGCAGTCGGCTCCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091916089 Original CRISPR TTCACCGCAGTCGGCTCCCA GGG Intergenic
900312946 1:2043279-2043301 TCCACCGCCCTCGGCTCCCTGGG - Intergenic
911104437 1:94118745-94118767 TTCTCCACAGTGTGCTCCCAGGG - Intronic
923276247 1:232399483-232399505 TTCATCCCACTCTGCTCCCATGG + Intronic
1064408906 10:15088612-15088634 GTCACCGCCGACCGCTCCCAGGG + Intronic
1070062848 10:73001932-73001954 GTCACCCCAGGCTGCTCCCAAGG - Intergenic
1077981241 11:7302921-7302943 CCTTCCGCAGTCGGCTCCCAAGG + Intronic
1091916089 12:4272641-4272663 TTCACCGCAGTCGGCTCCCAGGG + Intergenic
1102212735 12:111138862-111138884 TTCACCCCACACAGCTCCCAGGG + Intronic
1105503097 13:20989112-20989134 TTCCCCGGAGTCGGCCCCCACGG - Exonic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1124254849 15:28132040-28132062 CTCACCGCAGTCGGGCCCCCAGG - Intronic
1128977558 15:72164689-72164711 GCCACCACACTCGGCTCCCAGGG + Intronic
1131277475 15:90994277-90994299 GTCACGGCAGTCGGCGCCGAGGG - Intronic
1132600516 16:770705-770727 ATCCCCCCAGGCGGCTCCCATGG - Intronic
1133476373 16:6125653-6125675 CTGACTGCAGTCAGCTCCCAAGG - Intronic
1134136950 16:11683335-11683357 TTCACAGCAGTCTGCACGCATGG + Intronic
1142056995 16:88004196-88004218 TTCAACACAGTCCACTCCCAGGG - Intronic
1160879768 19:1314092-1314114 TTCCCCGCCGTCGGCCCCCAAGG - Intergenic
1162421028 19:10566144-10566166 ATCACCGCAGTCACCGCCCACGG + Intergenic
1166363354 19:42265707-42265729 TTCACTGCAGCAGGCTCCCTAGG + Intergenic
1167706848 19:51086266-51086288 TTCACCGCCGGTGGCTCCCAAGG + Intergenic
935387992 2:102521451-102521473 TTCTCCCCATTTGGCTCCCAAGG - Intronic
935788483 2:106570188-106570210 CTCACCCCAATCAGCTCCCAAGG - Intergenic
939432627 2:142130643-142130665 CTTACCTCGGTCGGCTCCCACGG + Exonic
941029211 2:160493087-160493109 ATCCCCGCACTCCGCTCCCAGGG + Intronic
941204323 2:162552761-162552783 ATCACTGCTTTCGGCTCCCAGGG - Intronic
949042853 2:241857532-241857554 TCCCCCGCAGTCGTCTCCCTGGG + Intronic
1174622439 20:51886170-51886192 CTCACCGCTGTGGGCTCTCAAGG + Intergenic
1181562288 22:23712656-23712678 TTCAGGGCAGTCTGCTCCTAAGG - Intergenic
1184349983 22:43937148-43937170 TTCCCCGGAGTCGGCTGCCTTGG + Exonic
954853326 3:53621472-53621494 TTCACCTCACTCCTCTCCCAAGG - Intronic
969869824 4:10097574-10097596 TACACAGAAGTGGGCTCCCAGGG - Intronic
977244726 4:94618019-94618041 TTCTCCGCAGTTGGCTTCCTCGG + Exonic
984811449 4:183798525-183798547 TCCCCCGCAGTCGCCGCCCAGGG - Intergenic
993713272 5:91249265-91249287 TTCACTGCAGTCTCCTCCCTTGG + Intergenic
999370541 5:151052441-151052463 TTCTCCGTAGTTGGCTCCCAAGG - Intronic
1019710430 7:2515918-2515940 CTCAGCACAGCCGGCTCCCAAGG - Intronic
1029291381 7:99504705-99504727 ACCACCGCAGTCGGCTCAGAAGG - Intronic
1037262849 8:17027358-17027380 GTCACCGCAGGCCGCCCCCACGG - Exonic
1051212461 9:14758996-14759018 TTCACCTCAGTCACTTCCCATGG - Intronic
1199602795 X:149552622-149552644 GTCACCGCCTTCTGCTCCCACGG + Intergenic
1199647594 X:149926853-149926875 GTCACCGCCTTCTGCTCCCACGG - Intergenic
1201622289 Y:15973463-15973485 TTCACCGCCTTCTGGTCCCATGG + Intergenic
1202018393 Y:20435539-20435561 TCCAGGGCAGTAGGCTCCCAGGG + Intergenic