ID: 1091916089

View in Genome Browser
Species Human (GRCh38)
Location 12:4272641-4272663
Sequence TTCACCGCAGTCGGCTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 39}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091916085_1091916089 -3 Left 1091916085 12:4272621-4272643 CCGACCGTGCTGGCGGCGACTTC 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1091916089 12:4272641-4272663 TTCACCGCAGTCGGCTCCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 39
1091916086_1091916089 -7 Left 1091916086 12:4272625-4272647 CCGTGCTGGCGGCGACTTCACCG 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1091916089 12:4272641-4272663 TTCACCGCAGTCGGCTCCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091916089 Original CRISPR TTCACCGCAGTCGGCTCCCA GGG Intergenic