ID: 1091918354

View in Genome Browser
Species Human (GRCh38)
Location 12:4285156-4285178
Sequence CTGAATATTGTACGTTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 159}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091918349_1091918354 -8 Left 1091918349 12:4285141-4285163 CCAGCCTTAAGAAGTCTGAATAT 0: 1
1: 0
2: 1
3: 5
4: 173
Right 1091918354 12:4285156-4285178 CTGAATATTGTACGTTTTGGGGG 0: 1
1: 0
2: 0
3: 12
4: 159
1091918346_1091918354 21 Left 1091918346 12:4285112-4285134 CCATCCTCTACTATCTAATGCAT 0: 1
1: 0
2: 2
3: 12
4: 168
Right 1091918354 12:4285156-4285178 CTGAATATTGTACGTTTTGGGGG 0: 1
1: 0
2: 0
3: 12
4: 159
1091918348_1091918354 -7 Left 1091918348 12:4285140-4285162 CCCAGCCTTAAGAAGTCTGAATA 0: 1
1: 0
2: 1
3: 14
4: 235
Right 1091918354 12:4285156-4285178 CTGAATATTGTACGTTTTGGGGG 0: 1
1: 0
2: 0
3: 12
4: 159
1091918347_1091918354 17 Left 1091918347 12:4285116-4285138 CCTCTACTATCTAATGCATTGAT 0: 1
1: 0
2: 0
3: 8
4: 142
Right 1091918354 12:4285156-4285178 CTGAATATTGTACGTTTTGGGGG 0: 1
1: 0
2: 0
3: 12
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091918354 Original CRISPR CTGAATATTGTACGTTTTGG GGG Intronic
904385506 1:30139289-30139311 CTGAAAATTATACCATTTGGGGG + Intergenic
905612932 1:39370961-39370983 CAGAATATTTTACATTTTTGAGG - Intronic
906627611 1:47338018-47338040 CAAAATAATGTAAGTTTTGGAGG + Intronic
909297753 1:73972498-73972520 CAGTATACTGTACGTTGTGGAGG + Intergenic
909410637 1:75346490-75346512 CTGAAGAATGGACGTTTAGGGGG + Intronic
909895057 1:81058369-81058391 GTGAATATTTTAGGTTTTGTGGG - Intergenic
910400308 1:86831461-86831483 CTAATTTTTGTACTTTTTGGTGG - Intergenic
910682072 1:89876795-89876817 CTAAATATTTTAGGCTTTGGAGG - Intronic
915158715 1:153900709-153900731 GTAAATATTTTAGGTTTTGGAGG + Intronic
916297435 1:163235333-163235355 TTATATATTGTACGTATTGGAGG - Intronic
916971179 1:170018281-170018303 GTCAATATTGTAGGTTTTGCAGG - Intronic
918868304 1:189933145-189933167 GTAAATATTCTAGGTTTTGGGGG + Intergenic
1063141000 10:3256620-3256642 CTGAACATTGTGTGTTTGGGGGG - Intergenic
1067123717 10:43497387-43497409 CTGAATATTCTAGGCATTGGAGG + Intergenic
1067548539 10:47215469-47215491 CTGAATAAAGTATCTTTTGGTGG - Intergenic
1072244333 10:93528479-93528501 CAAAATATTTTATGTTTTGGGGG + Exonic
1075775021 10:124977543-124977565 CTAAATTTTGTATTTTTTGGTGG - Intronic
1078721441 11:13887994-13888016 CTGAATACTTTAGGTTTTGCAGG - Intergenic
1078723930 11:13910962-13910984 CTGAATTTTGTACTTTTTTTTGG - Intergenic
1079946077 11:26742578-26742600 GTGAATATTTTAGGTTTTGTGGG - Intergenic
1080193323 11:29577702-29577724 CTAAATATTCTAGGTTTTGGTGG + Intergenic
1081443528 11:43106868-43106890 CTTAATATTGTAAGATTTGGGGG + Intergenic
1085181931 11:74543431-74543453 CTGAATATTGTACCTAGGGGTGG + Intronic
1085556233 11:77424705-77424727 CTGAAGATTAGAAGTTTTGGAGG - Intronic
1088038890 11:105352171-105352193 CTGAATATTGAACCTTTAGCAGG - Intergenic
1089964055 11:122640932-122640954 CTGAATTTTGTATATTTTGGGGG + Intergenic
1091918354 12:4285156-4285178 CTGAATATTGTACGTTTTGGGGG + Intronic
1099464845 12:82971156-82971178 CTGAACTTTGTAAGATTTGGGGG - Intronic
1101568256 12:105930076-105930098 ATAAATATTGTAGGTTTTGCAGG + Intergenic
1106236407 13:27864584-27864606 CTTAATAATGTACTTTCTGGTGG + Intergenic
1106293693 13:28390559-28390581 CTAATTTTTGTACTTTTTGGTGG + Intronic
1108892569 13:55278866-55278888 CTCAATATTGTTCTTTATGGTGG + Intergenic
1110298495 13:73898131-73898153 CTGAATACTTCAGGTTTTGGAGG - Intronic
1111158090 13:84354855-84354877 GTGTATATTATACGTTTTAGTGG - Intergenic
1111315395 13:86551419-86551441 CTGAATGTTGTTTGTTTTGCTGG - Intergenic
1111993958 13:95144641-95144663 CTAAATATTTTATGTTTTTGTGG - Intronic
1113138893 13:107125242-107125264 CTGAAAATTTTACATTTTGTAGG + Intergenic
1114915493 14:27259152-27259174 ATGAAAATTTTACATTTTGGTGG + Intergenic
1117073516 14:52077660-52077682 ATGAACATTCTACTTTTTGGAGG - Intergenic
1118211833 14:63772575-63772597 CTAAATTTTGTAATTTTTGGTGG - Intergenic
1120269413 14:82292393-82292415 GTGATTATTGTAAGGTTTGGAGG + Intergenic
1123713173 15:23006051-23006073 CTGGATGTTTTACTTTTTGGTGG - Exonic
1130183661 15:81656425-81656447 CTGATTATTCTATTTTTTGGGGG + Intergenic
1131917766 15:97289351-97289373 CTGGATGTTGTACGTTCTGTGGG + Intergenic
1131997564 15:98146948-98146970 AGGAACATTGTACATTTTGGAGG - Intergenic
1132024291 15:98391897-98391919 TTAAATATTTTACGTTTTTGAGG - Intergenic
1132354605 15:101162112-101162134 CTGAATATGATGGGTTTTGGAGG - Intergenic
1132438309 15:101831712-101831734 TTGAATATTGTACTTTTTCTTGG + Intergenic
1135622058 16:23964427-23964449 CTGAGTATTTTAGGTTTTGCAGG - Intronic
1135783999 16:25331699-25331721 CTGGATATTGGACTTTTTGGAGG + Intergenic
1140180555 16:72713478-72713500 TTGATTATAGTATGTTTTGGTGG + Intergenic
1140308223 16:73823695-73823717 CTGAATATTTTCAGTTTTGCGGG - Intergenic
1140432662 16:74917867-74917889 CTGAATCTTACACTTTTTGGTGG + Intronic
1141203970 16:81919009-81919031 GTGAATATTTTAGGTTTTGCAGG + Intronic
1150662355 17:67094154-67094176 CTAAATTTTGTATTTTTTGGTGG - Intronic
1153854157 18:9128679-9128701 ATGAAATTTGTACTTTTTGGGGG - Intronic
1155346137 18:24859315-24859337 CTGAAGACTGTATGTTTTGTGGG + Intergenic
1155735533 18:29218234-29218256 CTAAATATTTTAGGTTTTGTAGG - Intergenic
1155799763 18:30086853-30086875 CTGAATATTGCAGGCTTTGATGG - Intergenic
1156963713 18:43064399-43064421 CTAAGTAATGTACATTTTGGAGG + Intronic
1157692197 18:49692579-49692601 ATAAATATTGTAGGTTTTGTGGG - Intergenic
1158837347 18:61345128-61345150 CTCAATATTGTCCGGATTGGTGG - Intronic
1161052342 19:2171126-2171148 CTAAATTTTGTATTTTTTGGTGG + Intronic
1165081225 19:33307487-33307509 CTTAATATTCAAAGTTTTGGGGG - Intergenic
925404034 2:3594488-3594510 CCGAATCTTGCATGTTTTGGGGG - Intergenic
925667089 2:6269820-6269842 CAGAATATGGTTCATTTTGGTGG - Intergenic
928763561 2:34613510-34613532 CTTATTTTTGTACATTTTGGTGG - Intergenic
930286362 2:49433915-49433937 CTGCATATAGAACATTTTGGGGG + Intergenic
930743942 2:54861642-54861664 CAGACTATTGTCTGTTTTGGTGG - Intronic
933273936 2:80263875-80263897 CTGAATATTGTAACTTTATGTGG + Intronic
935246174 2:101220385-101220407 GTGAATATTTTAGGCTTTGGAGG - Intronic
936980216 2:118256819-118256841 CTGAATATTGTGTGTCTTGCAGG + Intergenic
937062750 2:118992529-118992551 CTGAAAATTGTGTGTGTTGGGGG + Intronic
938687029 2:133748527-133748549 CTGCATATTGTAATTTGTGGTGG - Intergenic
939625467 2:144471916-144471938 GTTAATAATTTACGTTTTGGTGG - Intronic
940003999 2:148994955-148994977 CTGACTCTTGTACTTTTGGGAGG - Intronic
940687084 2:156865326-156865348 AGGTATATTGTACCTTTTGGAGG + Intergenic
940973633 2:159920566-159920588 CTGATTTTTGTATTTTTTGGTGG + Intergenic
942789921 2:179749343-179749365 CTGGATATTGTACTTTTTAATGG - Intronic
942857901 2:180573531-180573553 CTGAATATTGAACATTTTAATGG - Intergenic
943349389 2:186779474-186779496 CTGAATGGTGTGTGTTTTGGGGG - Intergenic
1169772104 20:9212382-9212404 CTGAATATTGAATATCTTGGGGG + Intronic
1171174250 20:23039536-23039558 CTAAATATAGCACGTTTTGGCGG + Intergenic
1171235539 20:23521274-23521296 TTTAATATTGTACATTTTAGGGG + Intergenic
1173445933 20:43118321-43118343 CTGAATTTTGTACATTTTCTTGG - Intronic
1173734412 20:45348872-45348894 CTAAATATTTTAGGTTTTGCGGG + Intergenic
1174674999 20:52345151-52345173 GTAAATATTGTAGGTTTTGTGGG + Intergenic
1176882130 21:14208720-14208742 GTAAATATTTTACGTTTTGTGGG - Intronic
1177535481 21:22421857-22421879 GTAAATATTGTAAGTTTTGGGGG - Intergenic
1179582963 21:42356112-42356134 GTAAATATTGTAGGTTTTGGAGG - Intergenic
949188354 3:1220434-1220456 CTTGATATTGTTGGTTTTGGGGG + Intronic
949383549 3:3472819-3472841 CTGCATATTGGACATTTTGTAGG + Intergenic
949654130 3:6197376-6197398 GTGAATATTTTAGGTTTTGAGGG + Intergenic
950434564 3:12971114-12971136 ATTAATATTGTATGTTTTGCAGG - Intronic
952130251 3:30353709-30353731 CTAAATATTCTATGTTTTGCAGG - Intergenic
952721509 3:36538321-36538343 CTAAATATTGTAGGCTTTGCAGG - Intronic
956410472 3:68973535-68973557 CTGAATATTTTAGGCTTTGTGGG - Intergenic
956608468 3:71097407-71097429 GTGAATATTTTAGGTTTTGTGGG - Intronic
957380587 3:79423712-79423734 CTGAATACTGAATCTTTTGGTGG - Intronic
958220670 3:90671853-90671875 GTGAATATTTGAAGTTTTGGGGG - Intergenic
958665219 3:97128496-97128518 CTGAAAAATGTACATTTTGGGGG + Intronic
959561110 3:107782600-107782622 CTGAAAAATGAATGTTTTGGGGG - Intronic
959564095 3:107816551-107816573 ATGTATATTGTACGTTTAGAAGG - Intergenic
960242365 3:115360258-115360280 TTGAATTTTGTACTTCTTGGGGG + Intergenic
960977677 3:123191408-123191430 TTTAATATTGAACATTTTGGTGG + Intronic
961631745 3:128305484-128305506 CTGAATTTGATACTTTTTGGGGG + Intronic
964329741 3:155589216-155589238 GTGAATATTTTAAGTTTTGCAGG + Intronic
965136828 3:164784097-164784119 CTGATTTTTGTATTTTTTGGTGG + Intergenic
965297366 3:166966497-166966519 CTGCATATTGTACATTTTCTAGG - Intergenic
966847860 3:184144479-184144501 CTCACTCTTGTCCGTTTTGGAGG + Intronic
966998261 3:185306670-185306692 CTGGATATTAGACCTTTTGGTGG + Intronic
970153091 4:13110928-13110950 CTAAATATGGTCCATTTTGGAGG - Intergenic
971528677 4:27656692-27656714 GTGAATATTTTAGGTTTTGTGGG - Intergenic
973212583 4:47632944-47632966 CTAATTTTTGTACTTTTTGGTGG + Intronic
975334682 4:73162212-73162234 CTAATTATTTTACTTTTTGGAGG + Intronic
976457253 4:85262568-85262590 GTGAATGTTGTAAGTTTAGGGGG - Intergenic
977644346 4:99395358-99395380 CTTAAAATTGTACTTGTTGGAGG + Intergenic
978567724 4:110101949-110101971 CTCAATTTTTTACTTTTTGGGGG - Intronic
980342418 4:131567720-131567742 CTGAGTATTGTATGTTTCCGAGG + Intergenic
983219573 4:165031647-165031669 CTGATTGTTGTATTTTTTGGTGG - Intergenic
983293433 4:165835380-165835402 TTAAACTTTGTACGTTTTGGTGG + Intergenic
983613887 4:169679722-169679744 CTGATTTTTGTATTTTTTGGTGG - Intronic
985026553 4:185744707-185744729 CTGAATGTTGGACCATTTGGTGG - Intronic
988083741 5:26446097-26446119 CTCAATATTGTAGGTTTTAGAGG - Intergenic
988323693 5:29734590-29734612 CAGAATGATTTACGTTTTGGGGG - Intergenic
988459646 5:31422493-31422515 CTAAATATTTTAGGTTTTGTGGG - Intronic
989371718 5:40717536-40717558 CTGAATATTCTACATTATAGAGG - Intronic
990415671 5:55584123-55584145 CTGAATATTTTGCATTTTGATGG + Intergenic
992781215 5:80129916-80129938 CTGCATTTTGTATGTTGTGGTGG - Intronic
993934552 5:93985587-93985609 CTGGATTTTGTATTTTTTGGTGG + Intronic
995337544 5:111017846-111017868 CTGAATATTATATGTATTGTGGG + Intergenic
995563502 5:113408750-113408772 ATGAATATTGGTTGTTTTGGGGG + Intronic
1000139868 5:158392067-158392089 CTGAAGGTGGTACATTTTGGGGG + Intergenic
1003826662 6:9960306-9960328 CTGAATATTTTACGGTTTGCTGG - Intronic
1009991852 6:70852936-70852958 GTGAATATTTTAGGTTTTGTGGG - Intronic
1010824177 6:80452700-80452722 CAGAATGTTGTAGGTTGTGGTGG + Intergenic
1010899976 6:81414991-81415013 CCTAATATTGTAATTTTTGGGGG + Intergenic
1013112551 6:107075907-107075929 CTGAATATTGAGAGTTATGGGGG - Intronic
1014942437 6:127458629-127458651 TTGAATAATCTACGTTTAGGAGG - Intronic
1016887537 6:148971826-148971848 CTGAATCTTTTACATTTTGTGGG + Intronic
1017981784 6:159406905-159406927 CTGGTTTTTGTACTTTTTGGTGG + Intergenic
1018032545 6:159853446-159853468 CTGAATGTTCTATGATTTGGTGG - Intergenic
1019202127 6:170326567-170326589 ATAAATATTGTAGGTTTTGAGGG + Intronic
1020475488 7:8589346-8589368 CTGAAAATTGTAGTTTTTGATGG + Intronic
1021776398 7:24059181-24059203 ATAAATATTGTAGGCTTTGGGGG + Intergenic
1022080434 7:27014637-27014659 CTGAGTTTTGTACCTTCTGGTGG - Intergenic
1031372099 7:120980953-120980975 CTGATTTTTATAGGTTTTGGGGG + Intergenic
1031937527 7:127750987-127751009 CTGTATCTTGTCTGTTTTGGTGG + Intronic
1033490472 7:141838429-141838451 CTGAACAATGTCCATTTTGGTGG + Intronic
1036043740 8:5116269-5116291 CTTAATATTGTCAATTTTGGAGG - Intergenic
1042069610 8:64916572-64916594 CTGTATATTTCAAGTTTTGGTGG - Intergenic
1048863977 8:138745815-138745837 CTGAATCCTGAATGTTTTGGCGG - Intronic
1051066570 9:13111255-13111277 CTGAATATTTTAGGCTTTGTGGG - Intronic
1051897139 9:21998572-21998594 CTGAATATTGGAAGTTTTTGGGG + Intronic
1053358028 9:37463698-37463720 CTGAAAATGGTAAGATTTGGAGG - Intronic
1059267314 9:113047427-113047449 CTGAATATTTTAATGTTTGGTGG + Intronic
1061740136 9:132697063-132697085 GTGAATATTGTAGGCTTTGTGGG - Intergenic
1186166678 X:6833940-6833962 CTAAATGTTGTACTATTTGGGGG + Intergenic
1186368457 X:8920883-8920905 CTGTTTATTGTATATTTTGGTGG + Intergenic
1186553700 X:10534549-10534571 CTGAATTTTTTAGGTTTTAGAGG + Intronic
1189278758 X:39806197-39806219 CTAAATTTTGTATTTTTTGGTGG - Intergenic
1189764280 X:44354215-44354237 CTAAATATTGTGGGGTTTGGGGG + Intergenic
1190904417 X:54711563-54711585 CTGAATCTGGTACATTTAGGAGG - Intergenic
1190997694 X:55627108-55627130 GTGCATATTGTACACTTTGGGGG - Intergenic
1191031668 X:55980560-55980582 CTGAATATTGCACCTTTTCCTGG + Intergenic
1191674032 X:63776301-63776323 CTGAATTTTTTAAGCTTTGGGGG + Intronic
1192685190 X:73296983-73297005 CTCAATATAGTAGGTTTTGAAGG + Intergenic
1192707303 X:73540453-73540475 TTGAATTTGATACGTTTTGGTGG - Intergenic
1192892307 X:75403633-75403655 CTAAATATTTTACTTTTTTGTGG - Intronic
1193682951 X:84543847-84543869 TAGAATAATGTACATTTTGGGGG + Intergenic
1194748252 X:97654053-97654075 ATAAATATTTTACGTTTTGGAGG - Intergenic
1201594426 Y:15652011-15652033 CTAATTTTTGTACTTTTTGGAGG - Intergenic