ID: 1091922259

View in Genome Browser
Species Human (GRCh38)
Location 12:4314761-4314783
Sequence ATTACATTGTGACCAAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091922259_1091922262 23 Left 1091922259 12:4314761-4314783 CCAGCTTTTGGTCACAATGTAAT No data
Right 1091922262 12:4314807-4314829 TGAAAATATTTAAATGCCTGGGG No data
1091922259_1091922261 22 Left 1091922259 12:4314761-4314783 CCAGCTTTTGGTCACAATGTAAT No data
Right 1091922261 12:4314806-4314828 CTGAAAATATTTAAATGCCTGGG No data
1091922259_1091922260 21 Left 1091922259 12:4314761-4314783 CCAGCTTTTGGTCACAATGTAAT No data
Right 1091922260 12:4314805-4314827 GCTGAAAATATTTAAATGCCTGG No data
1091922259_1091922263 29 Left 1091922259 12:4314761-4314783 CCAGCTTTTGGTCACAATGTAAT No data
Right 1091922263 12:4314813-4314835 TATTTAAATGCCTGGGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091922259 Original CRISPR ATTACATTGTGACCAAAAGC TGG (reversed) Intergenic
No off target data available for this crispr