ID: 1091922959

View in Genome Browser
Species Human (GRCh38)
Location 12:4320668-4320690
Sequence GAGGCCTTTTCTATACTAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 137}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091922959_1091922969 25 Left 1091922959 12:4320668-4320690 CCGTCTAGTATAGAAAAGGCCTC 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1091922969 12:4320716-4320738 ACGGAGGGCGTCTGTCCCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 53
1091922959_1091922963 6 Left 1091922959 12:4320668-4320690 CCGTCTAGTATAGAAAAGGCCTC 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1091922963 12:4320697-4320719 GCCCGACTAAAGTTTGGTCACGG 0: 2
1: 23
2: 50
3: 132
4: 212
1091922959_1091922968 22 Left 1091922959 12:4320668-4320690 CCGTCTAGTATAGAAAAGGCCTC 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1091922968 12:4320713-4320735 GTCACGGAGGGCGTCTGTCCCGG 0: 1
1: 0
2: 1
3: 6
4: 78
1091922959_1091922962 0 Left 1091922959 12:4320668-4320690 CCGTCTAGTATAGAAAAGGCCTC 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1091922962 12:4320691-4320713 AAAGGAGCCCGACTAAAGTTTGG 0: 1
1: 3
2: 31
3: 143
4: 301
1091922959_1091922966 9 Left 1091922959 12:4320668-4320690 CCGTCTAGTATAGAAAAGGCCTC 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1091922966 12:4320700-4320722 CGACTAAAGTTTGGTCACGGAGG 0: 1
1: 1
2: 8
3: 17
4: 40
1091922959_1091922967 10 Left 1091922959 12:4320668-4320690 CCGTCTAGTATAGAAAAGGCCTC 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1091922967 12:4320701-4320723 GACTAAAGTTTGGTCACGGAGGG 0: 1
1: 7
2: 10
3: 43
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091922959 Original CRISPR GAGGCCTTTTCTATACTAGA CGG (reversed) Intergenic