ID: 1091924371

View in Genome Browser
Species Human (GRCh38)
Location 12:4332773-4332795
Sequence TAATCCGTCATTGTTGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 37}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091924368_1091924371 2 Left 1091924368 12:4332748-4332770 CCATTGTATGCTTCAGAAAAATG 0: 1
1: 0
2: 2
3: 28
4: 356
Right 1091924371 12:4332773-4332795 TAATCCGTCATTGTTGGGACTGG 0: 1
1: 0
2: 0
3: 5
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091924371 Original CRISPR TAATCCGTCATTGTTGGGAC TGG Intronic
909937240 1:81566377-81566399 TAGTCCATCATAGTTGAGACCGG + Intronic
913558410 1:119992860-119992882 TAAACCTTCATTGTTTGGAAAGG + Intronic
913639431 1:120797591-120797613 TAAACCTTCATTGTTTGGAAAGG - Intergenic
914279016 1:146152345-146152367 TAAACCTTCATTGTTTGGAAAGG + Intronic
914540064 1:148603287-148603309 TAAACCTTCATTGTTTGGAAAGG + Intronic
914626582 1:149467930-149467952 TAAACCTTCATTGTTTGGAAAGG - Intergenic
1064574634 10:16731885-16731907 TAAGCCGATATTGTTGGGACAGG + Intronic
1080430943 11:32199127-32199149 TATTCTGTCGTTGTTGAGACAGG - Intergenic
1087455743 11:98383904-98383926 CAATCCTACATTGTTGGCACAGG - Intergenic
1088794345 11:113255348-113255370 TAATGCTGCATTCTTGGGACTGG - Intronic
1091924371 12:4332773-4332795 TAATCCGTCATTGTTGGGACTGG + Intronic
1094401646 12:30068085-30068107 GAATCCGTCATTGTTGTGCCTGG + Intergenic
1099429898 12:82571151-82571173 TAAGCTGTCATAGTTGGGGCCGG + Intergenic
1106734131 13:32571948-32571970 CAAGCTGTCCTTGTTGGGACAGG - Intergenic
1110997893 13:82136904-82136926 TAATCCATCTGTTTTGGGACAGG - Intergenic
1112169492 13:96955940-96955962 TGATCCTTCAGTGTTAGGACAGG + Intergenic
1113220760 13:108099342-108099364 TAATTCATCATGGTTGGGAATGG - Intergenic
1115125362 14:29986269-29986291 AAATCCATCATTGCTGGGATAGG + Intronic
1125253499 15:37733980-37734002 AAATATGTCATTGTTGGGTCTGG - Intergenic
1132147222 15:99436189-99436211 CAATCAGTCATTGCAGGGACAGG + Intergenic
1141569035 16:84923060-84923082 TGCTCCGTCCTTGTTGGCACTGG - Intergenic
1148208742 17:45795431-45795453 TAATCCTTCACTGTGGGGGCTGG + Intronic
1148622802 17:49047011-49047033 AAATCCATCATTGTTAGAACTGG + Intronic
1152016022 17:77750743-77750765 TGATCAGTCATTATTAGGACAGG + Intergenic
1158905660 18:62008889-62008911 GAATCCATCATTGTTGAAACTGG - Intergenic
1165665738 19:37626375-37626397 GAATCTGTCATTTTTGGGCCAGG + Intronic
925663804 2:6231651-6231673 TAATTGGTTATTGTTTGGACAGG + Intergenic
1174898048 20:54471448-54471470 GAATCACTCATTGTTGGGACTGG + Intergenic
955129051 3:56145530-56145552 TAATCCTTCAGTGTTGGGGTAGG + Intronic
963713138 3:148770716-148770738 TATTCTGTCATTGTTGGGAGGGG - Intergenic
987462034 5:18223555-18223577 AAATCTGTCATTCTGGGGACTGG - Intergenic
989772938 5:45166564-45166586 TAATATGTCATTGCTGGGCCAGG + Intergenic
990430649 5:55732287-55732309 TAATCCTTCAGTCTTGGGAGAGG + Intronic
991043519 5:62199055-62199077 TAATGCATCATTGCTGGGATAGG - Intergenic
998463369 5:142325182-142325204 TAACCCGTGATTGCTGGGACTGG + Intronic
1004104680 6:12654842-12654864 ACACACGTCATTGTTGGGACAGG + Intergenic
1004644078 6:17542667-17542689 TACTCTGTCATTGTTAGGATGGG - Intronic
1009592817 6:65694639-65694661 TAACCAGTCAGTGTTGGGTCTGG - Intronic
1010986472 6:82431027-82431049 TAATACTTAATTGTTGGGGCAGG - Intergenic
1018560155 6:165093642-165093664 TATTCATTCATTGTTGGGTCAGG + Intergenic
1041345662 8:56894976-56894998 AAATCAGTCATTCTTGAGACAGG - Intergenic
1192486865 X:71534593-71534615 TTATCCGTAATTGTAGGGAGTGG + Intronic
1197903494 X:131398416-131398438 CATTCCCTCATTGTTGGTACTGG - Intronic