ID: 1091924577

View in Genome Browser
Species Human (GRCh38)
Location 12:4334715-4334737
Sequence GCAGCTGGTGGTAAACATAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091924572_1091924577 23 Left 1091924572 12:4334669-4334691 CCATTCCTGAAGTACGTTCTTTG 0: 1
1: 0
2: 0
3: 20
4: 177
Right 1091924577 12:4334715-4334737 GCAGCTGGTGGTAAACATAGTGG 0: 1
1: 0
2: 1
3: 11
4: 122
1091924573_1091924577 18 Left 1091924573 12:4334674-4334696 CCTGAAGTACGTTCTTTGAAAAG 0: 1
1: 1
2: 10
3: 130
4: 873
Right 1091924577 12:4334715-4334737 GCAGCTGGTGGTAAACATAGTGG 0: 1
1: 0
2: 1
3: 11
4: 122
1091924574_1091924577 -6 Left 1091924574 12:4334698-4334720 CCTCTAGTGTGTGTAGAGCAGCT 0: 1
1: 0
2: 1
3: 7
4: 80
Right 1091924577 12:4334715-4334737 GCAGCTGGTGGTAAACATAGTGG 0: 1
1: 0
2: 1
3: 11
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091924577 Original CRISPR GCAGCTGGTGGTAAACATAG TGG Intronic
901935247 1:12622151-12622173 GCAGCTGATGTTAAACTTCGTGG - Intergenic
902802712 1:18840267-18840289 GCTGCTGGTGGCATACATGGTGG - Exonic
905848633 1:41256925-41256947 GCAACTGTTAGGAAACATAGGGG - Intergenic
905878502 1:41448613-41448635 GCAGCTGATGGAAAACTCAGGGG + Intergenic
906136911 1:43506349-43506371 GGTGCTGGTGGTAATCACAGGGG - Intergenic
908786364 1:67738485-67738507 GAAGCTGGAGATAAACAGAGGGG - Intronic
909112464 1:71496417-71496439 GCAGCAGGTGGTAAAAAAAGGGG + Intronic
909460567 1:75908580-75908602 GGAGCTGGTGATCAACATCGTGG - Intronic
909937898 1:81574937-81574959 GCAGCTGGAAGTACACACAGAGG - Intronic
912421626 1:109546105-109546127 GCAGATTGTGGAAAGCATAGGGG + Exonic
920031347 1:203039089-203039111 GCAGCTGATGGTGAACATGCTGG + Intronic
921102774 1:211944888-211944910 GCAGCTGGCGCTAAAGGTAGAGG - Exonic
924626471 1:245699905-245699927 GCAGCTGGTTGAAAAGATATTGG + Intronic
1066611728 10:37255717-37255739 GCAGCTGGTGGCCATCATATTGG + Intronic
1069077987 10:64058443-64058465 GCATTTGGTGGTAAACATTCAGG - Intergenic
1069249690 10:66253243-66253265 GCACTTGGTGGTAATGATAGGGG - Intronic
1070358419 10:75663210-75663232 GAAGCTGCTGGCAGACATAGGGG - Intronic
1072511394 10:96129831-96129853 GCAGCTGCTGGTGAGCAAAGAGG + Exonic
1073310755 10:102539569-102539591 TCAACGGGTGGTAAAAATAGTGG - Intronic
1073754174 10:106563198-106563220 GAAGGTGTTGGTAAACATAATGG - Intergenic
1073816517 10:107213842-107213864 GCAGCTGGTGCTTAACCTCGAGG - Intergenic
1086362852 11:86077326-86077348 GAGGCTGGTGTTAATCATAGGGG - Intergenic
1086423400 11:86659990-86660012 GAAGCTGGTGTTGAAGATAGTGG - Intronic
1089158827 11:116422604-116422626 GCAGCTCCTGGTACACAGAGGGG + Intergenic
1090836397 11:130457361-130457383 GCAGCTGGTGGGAATCGTGGTGG + Intronic
1090848555 11:130550410-130550432 GCAGCAGGTTGTAAACCTACTGG - Intergenic
1091924577 12:4334715-4334737 GCAGCTGGTGGTAAACATAGTGG + Intronic
1093013867 12:14136802-14136824 GCAGATGTTGGTATACATAGTGG - Intergenic
1093168425 12:15832228-15832250 GCAGTTGGTGCTAAAAATGGTGG + Intronic
1095893520 12:47257638-47257660 GCAGCTGGTGGAAAACCTTAAGG + Intergenic
1097835273 12:64266558-64266580 CCTGCTGGTGGTGGACATAGTGG + Exonic
1100569379 12:95832724-95832746 GCAACTTGTGTTAAACATGGTGG + Intergenic
1101211842 12:102542643-102542665 GCAGCTGGTGGTACAAAGTGTGG + Intergenic
1105226515 13:18439590-18439612 GCAGCTGGTGGCTATCATACTGG + Intergenic
1106014609 13:25856833-25856855 GCAGCTGGTGATTACCATATTGG + Intronic
1106575994 13:30976257-30976279 GCTGCTGGTGGGAAACCTACAGG - Intergenic
1106845770 13:33736357-33736379 ACAGCTGATGGTAAACCTATGGG - Intergenic
1110034946 13:70672141-70672163 GCAACTGTGGGGAAACATAGAGG - Intergenic
1111598852 13:90446278-90446300 GCAGCTGGAGGTGAACAGAAAGG + Intergenic
1112994175 13:105552374-105552396 GTAGCTTGTGGTTAACAAAGAGG - Intergenic
1114010968 14:18368093-18368115 GCAGCTGGTGGCTATCATACTGG + Intergenic
1119772894 14:77232207-77232229 GCAGGTGTGGGTAAACATTGTGG - Intronic
1125344510 15:38705511-38705533 GCAGATGGTGGGAAATCTAGAGG + Intergenic
1126455569 15:48858273-48858295 TGAGCTGTTGGTAAAGATAGGGG + Intronic
1128293513 15:66497552-66497574 GCAGCAGGTGGTCACCACAGAGG + Intronic
1129826525 15:78638301-78638323 ACAGCTGGTGGTCAAGATGGGGG - Intronic
1130273396 15:82464072-82464094 GCAGCTGATGGTCTGCATAGGGG - Intergenic
1130465747 15:84191443-84191465 GCAGCTGATGGTCTGCATAGGGG - Intergenic
1130498518 15:84482093-84482115 GCAGCTGATGGTCTGCATAGGGG + Intergenic
1130588036 15:85196039-85196061 GCAGCTGATGGTCTGCATAGGGG - Intergenic
1131799428 15:96053919-96053941 ACAGCTGCTGGTAAACAAGGAGG - Intergenic
1135724130 16:24841427-24841449 GCAGCTCATGGTTAACTTAGGGG + Intergenic
1140834701 16:78782265-78782287 GCAGCTGAAGGTAAAGACAGCGG - Intronic
1147343726 17:39772553-39772575 GCAGGAGGTGGAAAACAGAGGGG + Intronic
1153443904 18:5151156-5151178 GCTGCTGCTGGTAAACAGGGAGG + Intronic
1154078015 18:11224277-11224299 GCAGCTGGCTGTAGACATGGTGG - Intergenic
1154526870 18:15299890-15299912 GCAGCTGGTGGCTATCATACTGG - Intergenic
1167631312 19:50627906-50627928 GGAGCTGGTGGAATACACAGGGG + Intronic
931451547 2:62371171-62371193 GCAGCTGGTTCTAAAGATAGAGG + Intergenic
932552271 2:72783941-72783963 GCAACTGGAAGAAAACATAGAGG - Intronic
933403775 2:81831915-81831937 GCAGATTTTGGTATACATAGGGG - Intergenic
933456017 2:82520258-82520280 ACAGCTGATGGTAAACTCAGTGG + Intergenic
934655231 2:96113880-96113902 ACAGGTGGTGGTAAACACAGAGG + Exonic
935987554 2:108689268-108689290 GCAGATGGTGGAAACCATATTGG + Intergenic
936126380 2:109791965-109791987 GCAGATGGTGGAAACCATATTGG + Intergenic
936218313 2:110579503-110579525 GCAGATGGTGGAAACCATATTGG - Intergenic
936714972 2:115175716-115175738 GTAGCTGGTGGTTATCATATTGG - Intronic
937133596 2:119532714-119532736 GCAGCTCATGGTAAACCCAGGGG - Intergenic
938525967 2:132131247-132131269 GCAGCTGGTGGCTATCATACTGG - Intergenic
938552621 2:132395147-132395169 GCAGCAGGTGGTACAGTTAGAGG - Intergenic
941453164 2:165684205-165684227 GCAGCAGGTGGAAAACAGAGAGG + Exonic
941771424 2:169349760-169349782 GCAGCTGTTGGTCAACCCAGAGG - Intronic
943043474 2:182830228-182830250 TCTGGTGGTGGGAAACATAGGGG + Intergenic
948042073 2:234910393-234910415 GCAGCTGGTGGTTAACACCTTGG - Intergenic
1170136312 20:13077597-13077619 GCAGCTAGTTGTGTACATAGAGG + Intronic
1170813701 20:19695435-19695457 GGAGCTGGTGGCAAAAAAAGAGG - Intronic
1171099521 20:22369760-22369782 GCAGCTGCTGGAAAACTGAGTGG + Intergenic
1176770566 21:13068615-13068637 GCAGCTGGTGGCTATCATACTGG + Intergenic
1180435462 22:15298897-15298919 GCAGCTGGTGGCTATCATACTGG + Intergenic
1180517658 22:16162708-16162730 GCAGCTGGTGGCTATCATACTGG + Intergenic
1181935933 22:26438280-26438302 CCAGCTGCTGTTAACCATAGTGG + Intronic
1182452879 22:30431677-30431699 GCATCTGGTGGTAGACAGTGGGG - Intergenic
953763418 3:45712825-45712847 TCAGATGTTGGTAAAGATAGTGG + Intronic
954192591 3:48974572-48974594 GCAGATGGTGGAAGACTTAGTGG + Intronic
956787031 3:72651453-72651475 GGAGATGGTGGTGAAGATAGCGG - Intergenic
956867655 3:73385332-73385354 GCAGCTCCTGTTAAACAGAGGGG + Intronic
960916584 3:122701516-122701538 GCTGCTGGTGGTAAACCTGGCGG - Exonic
966014531 3:175125228-175125250 GTAGCTGGTGGTTAACATACTGG + Intronic
966511473 3:180768231-180768253 GAAGCTGGGGGTAAAGAGAGGGG + Intronic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
969234628 4:5856999-5857021 GCAGATGGTGGTGATGATAGTGG - Intronic
970661894 4:18294445-18294467 CCATCTGATGTTAAACATAGGGG + Intergenic
971312189 4:25534959-25534981 GCAACTGGTGGAAAACAGAGTGG + Intergenic
986783306 5:11086401-11086423 GCAGTTGGTGCTAAACTTGGGGG - Intronic
988332639 5:29862341-29862363 GCACCCGGTGGTAATCATACTGG - Intergenic
989501316 5:42171388-42171410 ACAGATGGTTGTAAAAATAGAGG + Intergenic
999712319 5:154329553-154329575 GCAGCTAGAGGGAAACATAAGGG - Exonic
1001340440 5:170838691-170838713 GAAGCTTCTGGTGAACATAGTGG + Intergenic
1005714806 6:28536557-28536579 TCAGCAGGTGGTAGAAATAGGGG + Intergenic
1006061019 6:31419313-31419335 TCATCTGTTGGTAAACATATAGG + Intergenic
1009311108 6:62153908-62153930 GCAGGTGGTGGATAACATAGTGG - Intronic
1011063252 6:83295046-83295068 GCAACTGTGGGTAAATATAGAGG + Intronic
1011237532 6:85233775-85233797 CCAGCTTCTGGTAACCATAGTGG - Intergenic
1012172659 6:96038606-96038628 GCAGCTGGTGGGAAACATATTGG - Intronic
1013943205 6:115691019-115691041 GCAGAGGGTGGTAAACATAATGG + Intergenic
1015494286 6:133864805-133864827 GCAGCTGTGAGGAAACATAGGGG - Intergenic
1016345007 6:143103996-143104018 GCTGCTGGTGGTGACAATAGTGG + Intronic
1018074413 6:160198808-160198830 GCAGCTGGTGGATAACATTCTGG + Intronic
1018152176 6:160950719-160950741 GGAGCTGGAGGTAAACAAACTGG - Intergenic
1018197578 6:161368596-161368618 CCAGCTTGTGGTAAAGACAGTGG + Intronic
1018716742 6:166538855-166538877 CCAGCTCGTGGTAAACTCAGGGG - Intronic
1019613980 7:1950625-1950647 GCAGCTGGGGGCAGACATTGAGG - Intronic
1023555790 7:41421634-41421656 CAAGCTGGGGGAAAACATAGAGG + Intergenic
1023854987 7:44177416-44177438 GCAGCTGGGGGTAGGCACAGGGG - Intronic
1024393347 7:48839716-48839738 GCAGCCTGTGGTAGACATTGTGG - Intergenic
1027631058 7:80606837-80606859 CCAGCTGGTGGTAAAAGTACAGG + Intronic
1029253666 7:99254433-99254455 GCAGCAGGTGGCAGACATAAAGG - Intergenic
1032689869 7:134274099-134274121 GGAGCTGGTGGCCACCATAGTGG - Intergenic
1034402057 7:150868847-150868869 GAAGCTGGTGGGAAGCACAGGGG - Intergenic
1035007685 7:155680318-155680340 GCAGCTGGTGATAAGTAGAGGGG + Intronic
1036483440 8:9158252-9158274 AAAGCTGATGGAAAACATAGTGG - Intronic
1037522204 8:19691218-19691240 GCAGCAGGTGGTGAGCAAAGGGG + Intronic
1043040655 8:75258906-75258928 GCAGATGGTGGGAAAGAAAGAGG + Intergenic
1047977284 8:130142887-130142909 GCAGTTGGTGGGAAAGGTAGAGG + Intronic
1048081588 8:131134108-131134130 GAAGATGGTGGTAAACAAAGAGG - Intergenic
1048312667 8:133337669-133337691 GCAGGTGGTGGCAGACACAGTGG + Intergenic
1051173119 9:14339564-14339586 GCAGATGGTAGTAAATTTAGAGG - Intronic
1054414734 9:64862202-64862224 GCAGCTGGTGGCTATCATACGGG - Intergenic
1203565010 Un_KI270744v1:82437-82459 GCAGATGGTGGTGAACACAAAGG + Intergenic
1186360485 X:8836195-8836217 GCAGATGCTGGTAAATTTAGAGG - Intergenic
1186684816 X:11914744-11914766 GCAGCTGTGGCTAAACATATGGG + Intergenic
1186843491 X:13508518-13508540 GAAGATGGTGGTCGACATAGAGG - Intergenic
1194495439 X:94611891-94611913 GGAGGTAGTGATAAACATAGGGG - Intergenic
1195927056 X:110036944-110036966 GTAGCTAGTGGTAACCATATGGG + Intronic
1201678524 Y:16616057-16616079 GCAGCTGGAAGAAAACACAGGGG + Intergenic