ID: 1091928010

View in Genome Browser
Species Human (GRCh38)
Location 12:4371053-4371075
Sequence GACAAGGTGGTGCCTACTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091928010_1091928021 28 Left 1091928010 12:4371053-4371075 CCTGGAGTAGGCACCACCTTGTC 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1091928021 12:4371104-4371126 CTGCTGGCTGAAAATTGGCTTGG 0: 1
1: 0
2: 0
3: 17
4: 176
1091928010_1091928017 12 Left 1091928010 12:4371053-4371075 CCTGGAGTAGGCACCACCTTGTC 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1091928017 12:4371088-4371110 TATCTTTTCCAAGCCTCTGCTGG 0: 1
1: 0
2: 0
3: 17
4: 181
1091928010_1091928022 29 Left 1091928010 12:4371053-4371075 CCTGGAGTAGGCACCACCTTGTC 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1091928022 12:4371105-4371127 TGCTGGCTGAAAATTGGCTTGGG 0: 1
1: 0
2: 2
3: 16
4: 191
1091928010_1091928019 23 Left 1091928010 12:4371053-4371075 CCTGGAGTAGGCACCACCTTGTC 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1091928019 12:4371099-4371121 AGCCTCTGCTGGCTGAAAATTGG 0: 1
1: 0
2: 2
3: 11
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091928010 Original CRISPR GACAAGGTGGTGCCTACTCC AGG (reversed) Intronic
900484195 1:2913784-2913806 GGCAACGTGGTGCCTGCCCCAGG - Intergenic
900800772 1:4735756-4735778 GACAAGCTGCCGCCTCCTCCGGG + Intronic
901402555 1:9024855-9024877 GGCAAGATGGTGCCTCCTACAGG + Intronic
905262927 1:36731904-36731926 GATCAGGTGGTGCCTGCTCCTGG + Intergenic
908123929 1:61011913-61011935 GTCCACCTGGTGCCTACTCCTGG - Intronic
910213103 1:84814064-84814086 GAAAAGGTGGTTCCTGCTGCTGG - Exonic
910364841 1:86453752-86453774 GACAGTGTGTTGCCTACCCCTGG + Intronic
911127058 1:94350634-94350656 GACAACGTGGTGGCTGCTCATGG - Intergenic
911251725 1:95584161-95584183 GAGAGGGTGGTTCCTACTCCAGG + Intergenic
922550128 1:226488611-226488633 GACAAGGTGGTCCCAGCCCCTGG + Intergenic
924204597 1:241698726-241698748 GATCAGATGGTACCTACTCCAGG + Intronic
1062811694 10:471191-471213 GAAAAGCTGGTGCCACCTCCTGG - Intronic
1073144616 10:101272413-101272435 GCCAAGGTGGAGCCCTCTCCTGG - Intergenic
1073196447 10:101695164-101695186 GACATGGTGTCGCCTCCTCCCGG - Exonic
1084264559 11:67998139-67998161 GCCCAGATGGTGCCTTCTCCAGG + Intronic
1084499045 11:69524063-69524085 GACAAGTTTGTGCCTCCTTCTGG - Intergenic
1084725460 11:70938966-70938988 GAGAAGCTGGTGGCTAATCCAGG + Intronic
1089661038 11:119985430-119985452 GACAAGGTGCTGCCCATTCTGGG - Intergenic
1091702747 12:2674618-2674640 GACCAGGTGGTGCCCCCTGCAGG + Exonic
1091909973 12:4222029-4222051 GACATGGTGGTGTGTAATCCTGG - Intergenic
1091928010 12:4371053-4371075 GACAAGGTGGTGCCTACTCCAGG - Intronic
1093837080 12:23845685-23845707 GACAAGCAGGTGACTATTCCCGG + Intronic
1094416353 12:30220144-30220166 GAGAAACAGGTGCCTACTCCAGG - Intergenic
1098680239 12:73344914-73344936 GACAATGTGGTGACTCCTCAAGG - Intergenic
1100457954 12:94770638-94770660 GCCAAGCAGGTGCCTACTTCAGG + Intergenic
1100584259 12:95964831-95964853 GTCAAGGGGATGCCTAATCCAGG + Intronic
1100753017 12:97720233-97720255 GGCATGCTGGTGCCTACTCGTGG + Intergenic
1101685729 12:107018344-107018366 GCCAAGGTGGTGGAGACTCCTGG + Intronic
1102025249 12:109710941-109710963 GCCAAAGTGCTGCCTCCTCCAGG - Intergenic
1102891946 12:116566264-116566286 GGCAAGGTGCTTCCAACTCCTGG - Intergenic
1109731295 13:66417567-66417589 GACAATGTGGTGACTCCTCAAGG - Intronic
1110348217 13:74474102-74474124 GTCAAGATGGTGTTTACTCCTGG + Intergenic
1113597744 13:111546611-111546633 GATAAGGTGGGGGCTACTCTAGG - Intergenic
1115043476 14:28959696-28959718 GACAATGTGGTGACTCCTCAAGG + Intergenic
1120284335 14:82478841-82478863 GGCAAGGTTCTGCCTACTTCTGG - Intergenic
1121019598 14:90571343-90571365 GACAAAGTAGTGCCTCCTACTGG - Intronic
1121523507 14:94602400-94602422 GAGAAGGTGGGGCCTTCTCAGGG + Intronic
1122327863 14:100893282-100893304 GACATGGTGGTGTGTACTCAAGG - Intergenic
1127715071 15:61642066-61642088 AACAAAGTAGTGCCAACTCCAGG + Intergenic
1128557077 15:68639164-68639186 CACAAGGAGGTGCCTCCTTCAGG - Intronic
1130460685 15:84156731-84156753 GCCAAGGTGGGGCCCCCTCCAGG - Intergenic
1132879386 16:2155195-2155217 GACAAAGTGGTGCGTAGGCCAGG + Intergenic
1132907568 16:2290774-2290796 GACATGGTGGTGCATGCTCTGGG - Intronic
1137618841 16:49862669-49862691 GACAAGGAGGTTCCCACACCCGG - Intergenic
1139329639 16:66177314-66177336 GAGAAGGTGGTCTATACTCCAGG - Intergenic
1147979559 17:44266164-44266186 GACGAGGTAGTCCCTACTGCAGG + Intronic
1148741707 17:49897000-49897022 GACCAGGTGGGGCCTGCTCCTGG - Intergenic
1150450324 17:65261245-65261267 CACAAGGTGGTCCCCACTTCTGG + Intergenic
1155114567 18:22751847-22751869 GACATGGTGGTGGCTACAGCAGG - Intergenic
1159945424 18:74441277-74441299 GACACTGTGGGGCCTCCTCCGGG + Intronic
1160441905 18:78899494-78899516 GACAAGGTGGCGGCTCCACCTGG + Intergenic
1161594800 19:5145723-5145745 GACAAGCTGTCGCCTCCTCCCGG - Intronic
1163325700 19:16601767-16601789 GACAAGGTGGGGACACCTCCCGG + Intronic
1163898618 19:20081151-20081173 CTGAAGGTGGTGCCTAGTCCTGG - Intronic
1163948326 19:20561345-20561367 CTGAGGGTGGTGCCTACTCCTGG + Intronic
1165036719 19:33039062-33039084 GTCAATGTGGTGCTTATTCCTGG - Intronic
925442505 2:3900590-3900612 AACATGGAGGTGCCTACACCAGG - Intergenic
928396298 2:30945454-30945476 GAGAGGGTGGTGCCCACTGCTGG + Intronic
930722179 2:54648298-54648320 GACATGTTGGTGCCTATCCCTGG - Intronic
931233123 2:60390926-60390948 GACAACCTGGTGCCAACCCCTGG + Intergenic
935061494 2:99612037-99612059 GACATGGTGGTGACTTCCCCAGG - Intronic
935944382 2:108271962-108271984 GACAGGGTGTTTCCTACTCAGGG + Intergenic
937389998 2:121477131-121477153 TACAAAGTGGTCCCTACTCCAGG - Intronic
938109682 2:128555491-128555513 CACAAGGTGGCCCCTATTCCTGG + Intergenic
939849153 2:147283276-147283298 GACAAGGTGGTGATTCCTCAAGG + Intergenic
947317054 2:228871541-228871563 GACAAGGTGGCCCCAAGTCCAGG + Intronic
1174164758 20:48576775-48576797 GACAAGGGGGTGCCCCTTCCTGG + Intergenic
1174454359 20:50638900-50638922 GACCTGGTGGTGGCTATTCCAGG + Intronic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
1180595394 22:16969780-16969802 GCCATGGTGGTGGCCACTCCTGG - Intronic
1181296452 22:21843850-21843872 AACAAGGTGGTGTCCACTCTAGG + Intronic
1181875506 22:25937485-25937507 GACAGTGTGGTGGCTACTCTTGG - Intronic
1182795869 22:32991209-32991231 GGCATGGTGGTGCATACTACCGG + Intronic
1183749611 22:39712409-39712431 CACATGGTGGTGCCTCCTCATGG + Intergenic
1185082775 22:48718889-48718911 GACAAGGTGGCCCCTGCCCCCGG + Intronic
951562393 3:23981847-23981869 AACAAGGTGCTTCCCACTCCAGG - Intergenic
951963041 3:28349586-28349608 ACCAAGGTGGTGGCAACTCCAGG - Intronic
957447904 3:80338757-80338779 GACAGGGTGGGGCCATCTCCAGG + Intergenic
959069060 3:101686161-101686183 GACAGGGTGGTGCGTCCTTCTGG + Intronic
961381439 3:126498634-126498656 GGCCAGGGGGTGCCTCCTCCTGG + Intronic
961813051 3:129532764-129532786 AACAAGCAGGTGCCTACTGCGGG + Exonic
965066593 3:163857884-163857906 GACAAGGAGGTGCCTGAACCTGG - Intergenic
967106714 3:186260439-186260461 GACAATGGGGGGCCTACTCCAGG - Exonic
968092264 3:195906815-195906837 CACAAGGTGGGGGCTAATCCCGG + Intronic
971744082 4:30556815-30556837 GACAAGGTGGTAGCTGATCCTGG - Intergenic
972319995 4:37964641-37964663 GACAAGGGGCAGCCTACTGCGGG + Intronic
979022367 4:115519653-115519675 GACAATGTGGTGACTCCTCACGG - Intergenic
982837599 4:160141332-160141354 GAGCAGGTGGTGTCTACTCAAGG - Intergenic
984380470 4:178986330-178986352 GACAATGTGGTGACTCCTCAGGG - Intergenic
987061343 5:14246862-14246884 GGCATGGTGGTGCCCACTCCTGG + Intronic
990233145 5:53737036-53737058 GACAATGTGGTGCTTCCTCAAGG + Intergenic
990580512 5:57163326-57163348 GCCAAGCTGGTCTCTACTCCTGG + Intergenic
993742757 5:91560954-91560976 GACAATGTGGTGATTACTCAAGG + Intergenic
994345898 5:98685821-98685843 GACAGTGTGGTGATTACTCCAGG + Intergenic
998999550 5:147905385-147905407 GACAGGGTGGTGCCTGGTCTTGG + Intronic
999831700 5:155326352-155326374 GACAATGTGGTGACTCCTCAAGG + Intergenic
1002102623 5:176864929-176864951 GACAAGGTGGGCCCTGCTGCTGG - Intronic
1002550309 5:179984584-179984606 GACCAGGTGATGTTTACTCCAGG - Intronic
1005422288 6:25664849-25664871 GGCATGGTGGTGCATATTCCAGG - Intronic
1009496698 6:64358156-64358178 GCCCAGGTGGTGTCTATTCCTGG + Intronic
1014987330 6:128027799-128027821 GCCAAGTTGGTGCGTACTCCTGG + Intronic
1017061915 6:150492424-150492446 GAAAAGATGTTGCCTGCTCCAGG + Intergenic
1022192226 7:28027276-28027298 GAAAAAGTGGTTCCTACTGCTGG + Intronic
1025265942 7:57457045-57457067 TTGAAGGTGGTGCCTAGTCCCGG - Intronic
1025824761 7:65001463-65001485 CCTAAGGTGGTGCCTAGTCCTGG + Intronic
1026397972 7:69977843-69977865 GACATGGTGGTGAGTTCTCCAGG - Intronic
1027500521 7:78944589-78944611 CACATGGTGGTGCCTTTTCCTGG - Intronic
1031987399 7:128172019-128172041 TACAAGGAGGTCCCCACTCCAGG + Intergenic
1034297285 7:149985566-149985588 GATTGGGTGGTGCCCACTCCCGG - Intergenic
1034529181 7:151684772-151684794 GACAAGTTGGGGTCTCCTCCAGG + Intronic
1034808742 7:154111288-154111310 GATTGGGTGGTGCCCACTCCCGG + Intronic
1038651814 8:29410821-29410843 CACAAGGAGGTACCTACTTCGGG + Intergenic
1039885091 8:41650030-41650052 GACGAGGAGGGGCCTCCTCCCGG - Intronic
1044974101 8:97646297-97646319 GACAAAGTTGTGCCTTTTCCAGG - Intronic
1047346378 8:124032599-124032621 GGCATGGTGGTGCCTGCTCATGG + Intronic
1056755481 9:89379317-89379339 GACAAGGTGGGGGCCACTACGGG + Exonic
1061299836 9:129698067-129698089 CACAAGGTGGTCCCTGGTCCTGG + Intronic
1061979160 9:134090230-134090252 TACAAGGTTGTGCATACACCAGG + Intergenic
1189590140 X:42502160-42502182 GCCAAGGTTGTGCTTACCCCAGG - Intergenic
1196903566 X:120410120-120410142 GACAAGGGGGTGCCTGAACCTGG + Intergenic
1198936423 X:141905411-141905433 GACAAGGATATGCCTACTGCTGG + Exonic
1199688529 X:150287194-150287216 GACAAGGTGGGGTTTATTCCAGG + Intergenic
1200076358 X:153553264-153553286 GAGAAGGTGGTGGCTACCTCGGG - Exonic
1200230020 X:154439216-154439238 GACAAGGGGGTGCCTTATTCTGG - Intronic
1202378564 Y:24258449-24258471 GCCAAGGTGGGGCCCCCTCCAGG + Intergenic
1202492218 Y:25411672-25411694 GCCAAGGTGGGGCCCCCTCCAGG - Intergenic