ID: 1091928856

View in Genome Browser
Species Human (GRCh38)
Location 12:4378615-4378637
Sequence TAGCTTGACTTGCTACTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 65}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091928854_1091928856 10 Left 1091928854 12:4378582-4378604 CCAGTTGTCTCATGTTGCCAATA 0: 1
1: 0
2: 0
3: 9
4: 131
Right 1091928856 12:4378615-4378637 TAGCTTGACTTGCTACTGACTGG 0: 1
1: 0
2: 2
3: 3
4: 65
1091928853_1091928856 29 Left 1091928853 12:4378563-4378585 CCTGATCTTTAAAAACATTCCAG 0: 1
1: 0
2: 2
3: 17
4: 273
Right 1091928856 12:4378615-4378637 TAGCTTGACTTGCTACTGACTGG 0: 1
1: 0
2: 2
3: 3
4: 65
1091928855_1091928856 -7 Left 1091928855 12:4378599-4378621 CCAATAAGTTTCTAACTAGCTTG 0: 1
1: 0
2: 0
3: 10
4: 187
Right 1091928856 12:4378615-4378637 TAGCTTGACTTGCTACTGACTGG 0: 1
1: 0
2: 2
3: 3
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091928856 Original CRISPR TAGCTTGACTTGCTACTGAC TGG Intronic
905293345 1:36938426-36938448 AACCTTGACCTGCTACTGCCGGG + Intronic
907082852 1:51640614-51640636 TAGCTTGAATTGGGACTGAATGG + Intronic
908643685 1:66253536-66253558 TATCTGGACTTGCTCCTGAGAGG + Intronic
913538961 1:119800682-119800704 TATTTTGACTTGCTAGTGAATGG + Intronic
916607484 1:166357729-166357751 TAGCTTGACTTGATGCTGACTGG - Intergenic
922154502 1:223030445-223030467 TGGCTAGACTTGCTCCTGATTGG + Intergenic
1071829174 10:89354895-89354917 TGGCTAGGCTTGCTGCTGACTGG + Intronic
1078059877 11:8036316-8036338 TAGAATGACTTACTACTGCCAGG - Intronic
1079874489 11:25839475-25839497 TAGCTTGACATTCTTCTAACAGG - Intergenic
1084235096 11:67782640-67782662 CAGCTTGCCTTCCTACTGCCTGG - Intergenic
1087097499 11:94333457-94333479 TAGCTTGCTTTCCTAATGACTGG + Intergenic
1091928856 12:4378615-4378637 TAGCTTGACTTGCTACTGACTGG + Intronic
1095945374 12:47750692-47750714 CAGCTGGACTGGCTACTGGCTGG - Intronic
1100637462 12:96448645-96448667 TAGCTTGACTATCCACTTACTGG + Intergenic
1101275068 12:103190313-103190335 TAGCTTCACTGGCTGCTGATTGG + Intergenic
1104880233 12:132065620-132065642 TAGCTTGAGTTGCAGCTGATTGG - Intronic
1115364921 14:32547204-32547226 TAGCTTGATGTGCTCCTGCCTGG + Intronic
1117656848 14:57964209-57964231 TAGCTTGGCTAGCTAGTGAAGGG + Intronic
1120207823 14:81604996-81605018 TGGCTTGACTTTATATTGACTGG + Intergenic
1121307151 14:92913872-92913894 TAGCTTTACCTCTTACTGACTGG - Intergenic
1127065976 15:55239025-55239047 TAGCTTTAATTGCTTCAGACTGG + Intronic
1128163352 15:65439419-65439441 TAGCTTAACATTCTACTCACAGG - Intergenic
1131228763 15:90645843-90645865 TAGCTTCCCTTGCTTCTGCCCGG + Intergenic
1131362233 15:91803402-91803424 TTGCTTGACTCACTACTGTCAGG + Intergenic
1137600471 16:49752680-49752702 GGGCTTGACCTTCTACTGACTGG + Intronic
1146496401 17:33326411-33326433 ATGCTTGACTGGCTAATGACAGG + Intronic
1149216979 17:54369117-54369139 TAGCTTGATTGGCTACAGATGGG - Intergenic
1149316236 17:55441462-55441484 TTACTTGTCTTGTTACTGACAGG + Intergenic
1150685178 17:67314811-67314833 GGGCTTGACTTTCTACTGTCTGG + Intergenic
1157149840 18:45205647-45205669 TAGGTTGGTTTGCTAGTGACAGG - Intergenic
1162675565 19:12295522-12295544 TAGCTAGGCTTGCTACTGACTGG + Intergenic
924983012 2:240228-240250 TAGCTTGGCTTGCCTCTGTCAGG - Intronic
926614945 2:14987432-14987454 TAGCCTGGCTTAATACTGACAGG + Intergenic
926851164 2:17198860-17198882 TAGCTTGACTTATTTCTGTCTGG - Intergenic
933719611 2:85389711-85389733 GAGCTGGAGTTGCTGCTGACTGG + Intronic
939087622 2:137740648-137740670 TAGCATGATATGCTACTTACTGG + Intergenic
945130515 2:206566400-206566422 GTGCTTGACTTGCGAGTGACAGG - Intronic
1170329810 20:15196605-15196627 TGGCTTGGCTTACTACTGATTGG - Intronic
1170855176 20:20046195-20046217 TAGCTTGACTGGGTTCTCACAGG - Intronic
1175484195 20:59333378-59333400 TAGCTTGACCTGGGACTGGCTGG + Intergenic
1176942448 21:14940333-14940355 AAGCTTGACTTTCTACTTATTGG - Intergenic
949730521 3:7107075-7107097 TAGCCTGACTTGAGACTGACAGG + Intronic
955536604 3:59930242-59930264 TAGCCTGACTTGCATCTGACTGG - Intronic
962045359 3:131753726-131753748 TAGCTTGACTTCCATCAGACTGG + Intronic
968076963 3:195821296-195821318 AAGGTTGACCTGCTATTGACTGG + Intergenic
969820046 4:9713119-9713141 CAGCTTGCCTTCCTACTGCCTGG + Intergenic
977851081 4:101830574-101830596 AACCTTGAACTGCTACTGACTGG - Intronic
979714559 4:123821988-123822010 TTCCTTGACTTGCTATTTACTGG + Intergenic
979905762 4:126289393-126289415 TATCTTTACTTGCAAATGACAGG - Intergenic
979920167 4:126486946-126486968 TAGACTGAGTTGTTACTGACTGG - Intergenic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
986340803 5:6787820-6787842 TAGATTTACTTGGTGCTGACTGG - Intergenic
987679464 5:21116820-21116842 GAGCTTTACTTGCTTCTGACGGG - Intergenic
1001420856 5:171586211-171586233 TAGCCCGACTGGCAACTGACAGG - Intergenic
1002191015 5:177477698-177477720 TAGCTTGAATTGCAGCTGAGAGG + Intergenic
1010576837 6:77541958-77541980 TAGGGTGACTTGTTACTGAGAGG + Intergenic
1017812101 6:157990755-157990777 TACATTGACTTCTTACTGACTGG + Intronic
1018138916 6:160807254-160807276 TGGCTAGGCTTGCTACTGATTGG - Intergenic
1020318120 7:6921178-6921200 CAGCTTGCCTTCCTACTGCCTGG - Intergenic
1027601099 7:80242192-80242214 TAGCTTGACTGACTTCTGCCAGG + Intergenic
1034776886 7:153835980-153836002 CAGCTTTACTTCCTGCTGACGGG - Intergenic
1036613853 8:10373523-10373545 TACCTTGCCCAGCTACTGACTGG + Intronic
1043203286 8:77401388-77401410 TGGCTTGTCTTTTTACTGACTGG - Intergenic
1058854490 9:109047534-109047556 CAGCTTTACTTACCACTGACTGG + Intronic
1061400804 9:130367324-130367346 CAGCTTGTCTTGCTACTCCCAGG - Intronic
1185753729 X:2635797-2635819 TAGCATGTCTGGCTATTGACCGG + Intergenic
1186587039 X:10886062-10886084 GAGTAAGACTTGCTACTGACTGG - Intergenic
1187495436 X:19791200-19791222 TAGCTTGACTTGTTTCTATCAGG - Intronic
1190140695 X:47841052-47841074 TAGCATGACGGGCCACTGACAGG + Intronic
1190141295 X:47847531-47847553 GAGCTTGACTTGCTAAAGTCTGG + Intronic
1202039824 Y:20669779-20669801 CAGCATGGCTTGCTACTGGCAGG - Intergenic