ID: 1091931112

View in Genome Browser
Species Human (GRCh38)
Location 12:4396056-4396078
Sequence GAGGCACTCAACTCTGAGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091931112_1091931117 3 Left 1091931112 12:4396056-4396078 CCGGTCTCAGAGTTGAGTGCCTC No data
Right 1091931117 12:4396082-4396104 GAGGCTACAAAATACTAGAAAGG No data
1091931112_1091931119 21 Left 1091931112 12:4396056-4396078 CCGGTCTCAGAGTTGAGTGCCTC No data
Right 1091931119 12:4396100-4396122 AAAGGAGAAGAACTGGAAGAAGG No data
1091931112_1091931121 29 Left 1091931112 12:4396056-4396078 CCGGTCTCAGAGTTGAGTGCCTC No data
Right 1091931121 12:4396108-4396130 AGAACTGGAAGAAGGGATGAAGG No data
1091931112_1091931122 30 Left 1091931112 12:4396056-4396078 CCGGTCTCAGAGTTGAGTGCCTC No data
Right 1091931122 12:4396109-4396131 GAACTGGAAGAAGGGATGAAGGG No data
1091931112_1091931120 22 Left 1091931112 12:4396056-4396078 CCGGTCTCAGAGTTGAGTGCCTC No data
Right 1091931120 12:4396101-4396123 AAGGAGAAGAACTGGAAGAAGGG No data
1091931112_1091931118 14 Left 1091931112 12:4396056-4396078 CCGGTCTCAGAGTTGAGTGCCTC No data
Right 1091931118 12:4396093-4396115 ATACTAGAAAGGAGAAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091931112 Original CRISPR GAGGCACTCAACTCTGAGAC CGG (reversed) Intergenic
No off target data available for this crispr