ID: 1091936069

View in Genome Browser
Species Human (GRCh38)
Location 12:4435378-4435400
Sequence GTTAGATTCTCAGAAGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 13, 2: 59, 3: 95, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091936069_1091936072 0 Left 1091936069 12:4435378-4435400 CCTGCTCCTTCTGAGAATCTAAC 0: 1
1: 13
2: 59
3: 95
4: 210
Right 1091936072 12:4435401-4435423 TAATGCCTGATGATCTGAGGTGG 0: 847
1: 1053
2: 687
3: 346
4: 231
1091936069_1091936071 -3 Left 1091936069 12:4435378-4435400 CCTGCTCCTTCTGAGAATCTAAC 0: 1
1: 13
2: 59
3: 95
4: 210
Right 1091936071 12:4435398-4435420 AACTAATGCCTGATGATCTGAGG 0: 309
1: 1018
2: 891
3: 541
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091936069 Original CRISPR GTTAGATTCTCAGAAGGAGC AGG (reversed) Intronic
900784241 1:4637791-4637813 GTCAGATTATCAGAAGGCCCCGG - Intergenic
901104063 1:6741669-6741691 GTCAGAGTCTGAGAAGGAGATGG - Intergenic
901581503 1:10247896-10247918 GTTAGATTCTCATAAGGAGCGGG + Intronic
902313444 1:15599647-15599669 GTTAGATTCTCATAAGGAGTGGG + Intergenic
904294659 1:29511506-29511528 GTTAGATTTTCATAAGGAGCAGG + Intergenic
904789233 1:33006114-33006136 ATTAGATTCTCACAAGGAGCGGG + Intergenic
904811535 1:33166112-33166134 ATTAGATTCTCATAAGGAGCAGG - Intronic
905082897 1:35340565-35340587 ATTAGATTCTCATAATGGGCAGG + Intronic
906089879 1:43169928-43169950 ATTAGATTCTCATAAGGAGCAGG - Intronic
908172203 1:61516459-61516481 GTTAGATTCTCATAAGGAGCAGG - Intergenic
909235388 1:73146795-73146817 ATTAGATTCTCATAAGAAGCAGG - Intergenic
909660489 1:78076493-78076515 ATTAGATTATCATAAGGTGCAGG + Intronic
909835762 1:80252437-80252459 GTTAGTTTCTCAGAAAGATAAGG - Intergenic
910545224 1:88408316-88408338 ATTAGATTCTCATAAGAAGCAGG + Intergenic
910868927 1:91813876-91813898 GTGAGATTCTCATAAGGAGCAGG + Intronic
911131051 1:94388901-94388923 GTTAGATCCTCAGAAGGTCTTGG - Intergenic
911147059 1:94562557-94562579 ATTAGACTCTCATAAGGAGCGGG + Intergenic
911293952 1:96090617-96090639 GTTAGTTTCTCATAAGGAATGGG - Intergenic
911494678 1:98616599-98616621 ATTAGATTCTCATAAGAAGGGGG - Intergenic
911898198 1:103466873-103466895 ATTAGATTCTCATAAGGAGTGGG + Intergenic
912062580 1:105690975-105690997 ATTAGATTGTCATAAGGAGCAGG - Intergenic
913579427 1:120211051-120211073 ATTAGATCCTCATAAGAAGCAGG - Intergenic
913628745 1:120687337-120687359 ATTAGATCCTCATAAGAAGCAGG + Intergenic
916396507 1:164394697-164394719 ATTAGAATCTCAGAAGAAGAAGG + Intergenic
918762744 1:188434771-188434793 ATTAGATTCTTATAAGGAGTGGG + Intergenic
918772266 1:188576665-188576687 ATTAGATTCTAAGAAAGGGCTGG + Intergenic
920213262 1:204344289-204344311 GTTTGTTTTTGAGAAGGAGCGGG - Intronic
920990768 1:210937199-210937221 GGTAGATTCTGAGAAGCAGTGGG - Intronic
921006001 1:211094192-211094214 ATTAGATTCTCATAAGGAGCAGG + Intronic
921697169 1:218224972-218224994 GTTACATTCTCAGAGAGTGCAGG + Intergenic
924072744 1:240298675-240298697 ATTAGGTTCTCATAAAGAGCAGG - Intronic
924642711 1:245849301-245849323 ATTGGATTATCAGAAAGAGCAGG + Intronic
1063092415 10:2878975-2878997 GTTAGATTCTGAGTAGAAGGAGG - Intergenic
1063904286 10:10766589-10766611 GTTAGGTACTCAGCAGCAGCAGG + Intergenic
1065931554 10:30483766-30483788 ATTAGATTTTCATAAGGAGCAGG - Intergenic
1066019217 10:31280248-31280270 ATTAAAGTCTCAGAAGGAACTGG + Intergenic
1066242102 10:33547985-33548007 TTTAGATTCTTATAAGGAGAGGG + Intergenic
1066280574 10:33913779-33913801 ATTAGATTCTCATAAGGAGCAGG + Intergenic
1066697705 10:38093606-38093628 TTTAGAGACTCAGAAGGGGCTGG - Intergenic
1067918212 10:50423478-50423500 GTTTAATTCTCAGAAGCAGAAGG + Intronic
1068201749 10:53792061-53792083 GGTAGATTGTGAGAAGGAGAAGG - Intergenic
1068603317 10:58978523-58978545 GTTAGAGTCGCATAAGGAGCGGG + Intergenic
1069358450 10:67614493-67614515 ATTAGATTCTCATAAGGAGTAGG + Intronic
1069641242 10:69956833-69956855 GTCAGAACCTCAGAAGGAGGTGG - Intronic
1070842722 10:79498786-79498808 GTAAGATTCTCATAAGGAGCCGG - Intergenic
1072672305 10:97439489-97439511 ATTAGATTCTCATAAGGAGTGGG - Intronic
1072990410 10:100186947-100186969 ATTAGATTCTCACAGGGAGCCGG + Exonic
1073199932 10:101727117-101727139 GTTAGATTCTCATAAGGAGTGGG + Intergenic
1073615430 10:104990420-104990442 GTTAGAGTCTCCCCAGGAGCAGG - Intronic
1073916955 10:108416802-108416824 GCTAGATTCTGAGATGGAGGTGG - Intergenic
1074409641 10:113215465-113215487 ATTGAATTCTCAGAAGGAGCAGG - Intergenic
1074568528 10:114603361-114603383 GTGAGATTCTGACTAGGAGCAGG + Intronic
1074821931 10:117186132-117186154 ATTAGATTCTCATAAGGAGCAGG - Intergenic
1075880622 10:125847799-125847821 ATTAGATTCTCATAAGGAGCGGG + Intronic
1075927840 10:126267510-126267532 ATTAGATTCTCATAAGGAGCAGG + Intronic
1075977939 10:126713018-126713040 ATTAGATTCTTATAAGGAGAGGG - Intergenic
1075993447 10:126857549-126857571 ATTAGATCCTCACAAGGAGCTGG - Intergenic
1076201340 10:128561067-128561089 ATTAGATTCTCATAAGGAGTGGG + Intergenic
1076237775 10:128879112-128879134 TTTAGATGCCCAGAAGGAGAAGG + Intergenic
1076621221 10:131789382-131789404 ATTAGATTCTCATAAGCAGTGGG - Intergenic
1077929867 11:6719998-6720020 GTCAGATTCAGAGCAGGAGCAGG - Intergenic
1080426813 11:32162756-32162778 ATTAGATTGTTAGAAAGAGCAGG - Intergenic
1080869864 11:36227776-36227798 GTGACATTCCCAGGAGGAGCAGG - Intronic
1083530172 11:63413554-63413576 ATTAGATACTCAGAAGGGGAGGG + Intergenic
1083804281 11:65064696-65064718 GGTAGAGTCTCAGAAGGGGTGGG + Intergenic
1084158888 11:67333637-67333659 ATTAGATTCTCATAAGGAGCTGG - Intronic
1084768818 11:71329542-71329564 ATTAGATTCTCATAAGGAGTGGG + Intergenic
1084862064 11:72025520-72025542 GTTCCATTTTCAGAAGCAGCAGG + Intronic
1085503899 11:77044911-77044933 AGTAGATTCTCATAAGGAGCAGG + Intergenic
1085938254 11:81176751-81176773 ATTAGATTCTCATAAGGAGTGGG + Intergenic
1087337718 11:96865623-96865645 GTTAGATTGCCAGGAAGAGCAGG - Intergenic
1087656472 11:100929184-100929206 GTTAGATTCTCATAAGGAGCAGG + Intronic
1088404125 11:109453261-109453283 ATTAGAGTCTCAGAAGAAGAGGG + Intergenic
1088432469 11:109773922-109773944 GTGAGATCCTCAGAGGGAGAAGG - Intergenic
1088698703 11:112392515-112392537 GTTATGTTCTTAGAAGGAACAGG - Intergenic
1089377133 11:118002331-118002353 GTTATTTTCTCAGAATGAACTGG - Intergenic
1090485386 11:127107970-127107992 ATTAGATTCTTATAAGGAGCAGG - Intergenic
1091936069 12:4435378-4435400 GTTAGATTCTCAGAAGGAGCAGG - Intronic
1091986695 12:4915330-4915352 GACAGATTTTCAGAAGAAGCTGG - Exonic
1092496941 12:9005785-9005807 GTTAGATTTTCTTAAGGAGCAGG + Intronic
1093065906 12:14657688-14657710 GTTAGATTCTCATAAGGATAAGG - Intronic
1094344124 12:29448136-29448158 ACTAGATTATCATAAGGAGCAGG + Intronic
1095581267 12:43802330-43802352 GTTAGATTCTCAGAATGCCCAGG - Exonic
1096061320 12:48703037-48703059 ATTAGATTCTCATAAAGAGCAGG - Intronic
1096490255 12:52009160-52009182 GTAAGATGGTCAGAAGGAGCAGG - Intronic
1096691368 12:53324148-53324170 GTTGGATTCTCATAAAAAGCGGG + Intronic
1096944165 12:55385835-55385857 CTTAGATCATCAGAAGGAGAGGG - Intergenic
1097050114 12:56217805-56217827 ATTAGATTCTCATAGGGAGTGGG - Intronic
1097417505 12:59329986-59330008 GATAGATTCAGAGAAGGAGCCGG + Intergenic
1098541126 12:71658964-71658986 GTCAGATTCTCAGAGGGGTCAGG - Intronic
1099833262 12:87873180-87873202 GTTAGATTCTGAGAAGGATATGG - Intergenic
1100092792 12:90992133-90992155 ATTAGATTCTCATAAGAAGCAGG + Intronic
1100324827 12:93531016-93531038 ATTAGATTTTCATAAGGAGCGGG + Intergenic
1100715662 12:97302565-97302587 ATTAGATGCTCATAAGGAGTGGG + Intergenic
1101915084 12:108889681-108889703 GGTAGCCTCTCTGAAGGAGCTGG - Intronic
1103529499 12:121590943-121590965 GTTTGTTTCTCAGAAGTTGCAGG - Intergenic
1104624557 12:130340426-130340448 ATTAGATTCTCATAAGGAGCAGG + Intronic
1104680302 12:130746531-130746553 ATTGGATTCTCCTAAGGAGCAGG + Intergenic
1107290835 13:38851486-38851508 GTTAGATCCCTGGAAGGAGCTGG + Intronic
1107797195 13:44064921-44064943 ACTAGATTCTCATAAGGAGCAGG + Intergenic
1108588879 13:51894947-51894969 GTTAGATTCTCATAAGGAGTGGG + Intergenic
1109373563 13:61458138-61458160 ATTAGATTCTCATAAAGAGCAGG - Intergenic
1110358375 13:74595574-74595596 GTTGGATTATCATAAGGAGTGGG + Intergenic
1110592125 13:77275525-77275547 TAAAGACTCTCAGAAGGAGCTGG + Intronic
1111070625 13:83161224-83161246 GTGAGATTCTTAACAGGAGCAGG + Intergenic
1111592665 13:90370184-90370206 ATTAGATTCTCATAAGGAGCAGG + Intergenic
1112022507 13:95383956-95383978 ATTAGATTCTCATAAGGAGGGGG - Intergenic
1112032971 13:95474223-95474245 ATTAGATTCTGATAAGGAGGAGG + Intronic
1113360390 13:109625567-109625589 GTAAGATTCTTAGAAGCTGCTGG + Intergenic
1114890444 14:26915091-26915113 ATTAGATTCTCATAAAGAGCAGG + Intergenic
1116394792 14:44434682-44434704 GTTACATTCCCAGAAGAATCAGG + Intergenic
1116642277 14:47479609-47479631 GTTAGATGCCAAGAAGAAGCAGG - Intronic
1116643538 14:47496936-47496958 ATTAGATTCTCATAAGGAGCAGG + Intronic
1116966078 14:51016395-51016417 ATTAGATTCTCATAAGGAGCGGG - Intronic
1119012147 14:71004489-71004511 ATTGGATTCTCATAAGGAGTGGG - Intronic
1119121581 14:72084191-72084213 ATTAGATTCTCATAAGGAGTGGG + Intronic
1119122246 14:72090462-72090484 ATTAGATTCTCATAAGGAGCAGG - Intronic
1119203732 14:72778382-72778404 ATTAGATTCTCATAAGGAGTGGG - Intronic
1119772693 14:77230652-77230674 GTTAGAGTCTCATAAGGAGCAGG - Intronic
1121037552 14:90718948-90718970 GTTAAATTCTCAAAAGAAGAGGG - Intronic
1202894258 14_KI270722v1_random:189074-189096 ATTAGATTATCATAAGGAGCAGG - Intergenic
1125860746 15:42997213-42997235 ATTAGATTTTCATAAGGAGTGGG - Intronic
1126434162 15:48618860-48618882 ATTAGATTCTCATAAGGAGTGGG - Intronic
1127365883 15:58289771-58289793 TTTAGATTCTCAGAAGTAAGTGG + Intronic
1127884085 15:63183932-63183954 ATTAGATTCTCATAAGGAGTGGG - Intergenic
1128110546 15:65073402-65073424 ATTAGATTGTCATAAGGAGCAGG + Intronic
1128855954 15:71015390-71015412 ATTAGATTCTCATAAGGAGTGGG + Intronic
1131100447 15:89684891-89684913 CTTATAATCTCAGAAGGGGCTGG + Intronic
1132077860 15:98837773-98837795 TTTAGAGTTTGAGAAGGAGCAGG - Intronic
1132170814 15:99652263-99652285 ATTAGATTCTCATAAGGAATGGG + Intronic
1132209494 15:100009425-100009447 CTCAAATTCTCAGAAGGACCTGG + Intronic
1134150910 16:11804240-11804262 CTGAGATTCTCAGCAGGAGCTGG + Intergenic
1134324424 16:13193938-13193960 GCTAGAGTCTCAGAGGAAGCAGG + Intronic
1134355177 16:13475825-13475847 GTTAGATTTTCATAAGGAACAGG + Intergenic
1135143597 16:19942286-19942308 GATAAATTCCCAGAAGAAGCAGG + Intergenic
1135191433 16:20357869-20357891 ATTAGATTCTCATAAGGAGCCGG + Intergenic
1135341140 16:21649105-21649127 CTTAGCTTCTCAAAAGTAGCTGG + Intronic
1135853335 16:25984317-25984339 ATTAGATTCTCATAAGGAGCAGG + Intronic
1138100968 16:54252223-54252245 ATTAGATTCTCATAAGGAGCAGG - Intronic
1141281418 16:82632904-82632926 ATTAGACTCTCATAAGGAGAAGG + Intronic
1142798756 17:2330449-2330471 TTTAGACTGTCAGAAGCAGCTGG + Intronic
1144227246 17:13161237-13161259 GTTAAATTTTCAGGGGGAGCTGG + Intergenic
1146012084 17:29204237-29204259 GTTAGATTCTCAGAATGCCCAGG - Intergenic
1146168467 17:30612352-30612374 GTTAGATTCTCATAAGGAGCAGG + Intergenic
1146221435 17:31025852-31025874 ATTAGATTCTCATAAGGAGCAGG + Intergenic
1146389014 17:32403785-32403807 GTTGGGTTCTGAGAAGGGGCAGG + Intergenic
1146393328 17:32442846-32442868 ATTAGATTCTCATAAGGAGCAGG - Intergenic
1148140575 17:45325079-45325101 GTTAGATACTAAGATGGAACAGG - Intergenic
1149314707 17:55428108-55428130 ATTAGATTCTCATAAGGAGCGGG - Intergenic
1150366364 17:64589654-64589676 ATGAGAGTCTCATAAGGAGCTGG - Intronic
1151019338 17:70595996-70596018 ATTAGAGTCTCAGAATGAGGTGG + Intergenic
1151413425 17:73946235-73946257 ATTAGATTCTCATAAGAGGCTGG + Intergenic
1151573712 17:74940652-74940674 ATTAGATTCTCATGAGGAGTGGG - Intronic
1151636767 17:75354531-75354553 ATTAGATTCTTACAAGGAGCGGG - Intronic
1152267485 17:79304797-79304819 CTAAGATTCTCGGAAGGTGCTGG + Intronic
1153144594 18:2016248-2016270 ATTAGATTCTCATAAGGAGCAGG - Intergenic
1153342342 18:3988507-3988529 ATTAGATTCTCATAAGGAGCGGG + Intronic
1155394153 18:25368471-25368493 ATTAGATTCTCATAAGGAGCTGG + Intergenic
1155663299 18:28277631-28277653 GTTACATTTTCTAAAGGAGCGGG + Intergenic
1155668759 18:28344071-28344093 ATTAGATTCTCATAACGAGCAGG + Intergenic
1155908308 18:31478860-31478882 ATTAGATTATCATAAGGAGCAGG + Intergenic
1156053033 18:32961651-32961673 ATTCGATTCTCATAAGGAGCAGG + Intronic
1156215739 18:34996333-34996355 ATTAGATTTTCATAAGCAGCGGG + Intronic
1156692609 18:39726540-39726562 GATAGAGCCACAGAAGGAGCAGG - Intergenic
1157474055 18:48010120-48010142 GTTAGATCCTCATAAGGAGCAGG - Intergenic
1158421080 18:57294885-57294907 ATTAGATTCTCATAAGGAGCAGG - Intergenic
1160190796 18:76712625-76712647 GACAGAATCTGAGAAGGAGCAGG - Intergenic
1160191348 18:76716768-76716790 GACAGAATCTGAGAAGGAGCAGG - Intergenic
1160929520 19:1563604-1563626 GTTGGGGTCTCAGCAGGAGCAGG + Intronic
1161922088 19:7274190-7274212 GTTAGATTCTCATAAGGAGCAGG + Intronic
1163010628 19:14423376-14423398 GTTAGATTCTCATAAGGAATGGG + Intergenic
1164810466 19:31150856-31150878 CTTAGATTCTGAGGATGAGCAGG - Intergenic
1165479233 19:36052348-36052370 ATTAGATTCTCATAAAAAGCGGG - Intronic
1166017177 19:39991083-39991105 ATCAGATTCTCATAAGGAGCGGG + Intronic
1166233749 19:41441394-41441416 ATTAGATTCTCATAAGGAGCAGG + Intergenic
1166837447 19:45676270-45676292 GTTCAGTTCTTAGAAGGAGCTGG + Intronic
1168644122 19:58049089-58049111 GTTAGTTCTTCAGAAGTAGCTGG + Intronic
925892983 2:8451075-8451097 ATTAGATTCTCATAAGGAGCAGG + Intergenic
926374746 2:12215359-12215381 ATTAGATTCTCACAAGGAGCAGG - Intergenic
929322829 2:40566138-40566160 GTTCGATTCTGGGAAGGAGTGGG - Intronic
929527085 2:42714780-42714802 GTTAGAGGCTCATAAGGAGCAGG + Intronic
929847523 2:45545586-45545608 GTTAGTTTCTCAAAAGGACTGGG + Intronic
930797168 2:55405742-55405764 ATTAGATTCTCATAAGGAGTGGG - Intronic
931002079 2:57795888-57795910 GTTTACTTCTCAGAAGGAACTGG - Intergenic
933227833 2:79771572-79771594 ATTAAATTCTCATAAGGATCTGG + Intronic
937014216 2:118588884-118588906 CTTAGATTCTCATAAGGAGGAGG + Intergenic
939627100 2:144491143-144491165 GATGGAGTCTCTGAAGGAGCTGG + Intronic
940311429 2:152282983-152283005 ATAAGATTCTCAGAAGGTCCTGG - Intergenic
940449435 2:153818784-153818806 GTAAAATGCTCAGATGGAGCAGG - Intergenic
940646067 2:156394086-156394108 ATTAGATTCTTATAAGGAGCCGG + Intergenic
940890826 2:159033700-159033722 GTTAGCACCTCAGATGGAGCCGG + Intronic
941350059 2:164420738-164420760 GTTAGATTCTCATAAGGAGCAGG + Intergenic
942477648 2:176344818-176344840 GTTAGATTCTTATAAGGATCAGG - Intergenic
942565062 2:177257828-177257850 ATTAGATTGTCCTAAGGAGCTGG - Intronic
943120019 2:183724142-183724164 ATTAGATTCTCGTAAGGAACAGG - Intergenic
943201425 2:184830877-184830899 GTTATTTTCTCAGAAGTAGTTGG - Intronic
943244674 2:185431417-185431439 AATAGATTCTCATAAGGAGTAGG - Intergenic
946315238 2:218906956-218906978 GTGAGAGTCTGAGAAGAAGCCGG - Intergenic
946596386 2:221310136-221310158 GTGAGATTCTCAGAGGGAGCAGG + Intergenic
947794884 2:232888038-232888060 TTTGGATGCTCACAAGGAGCTGG - Exonic
947926414 2:233925993-233926015 GTTAGAGTCTCAGGATGACCTGG + Intronic
948654724 2:239469469-239469491 ATTAGATTCTCATAAGAGGCAGG + Intergenic
948757622 2:240168573-240168595 GTTAGATTCCCATAAGGAGGGGG + Intergenic
1169765279 20:9141913-9141935 GTTAAAGTGTGAGAAGGAGCAGG + Intronic
1174906470 20:54557333-54557355 ATTAGATTCTCATAAGGAGCAGG + Intronic
1175345663 20:58272768-58272790 GTCAGATTGTCAGAAGATGCAGG - Intergenic
1177127419 21:17212821-17212843 GTTAGATTCTCATAAGGAGCAGG + Intergenic
1177597552 21:23265591-23265613 GTTAGATTATCTTAAGGAACAGG - Intergenic
1178672948 21:34608002-34608024 ATTAGATTCTCATAAGGAGTGGG - Intronic
1180197186 21:46204410-46204432 ATAAGATTCTCAGAAGGAAGAGG + Intronic
1183226427 22:36553348-36553370 GTTAGAGTCTCATAAGGAACAGG + Intergenic
1183700946 22:39450629-39450651 ATCAGATTCTCAAAGGGAGCAGG - Intergenic
1185109948 22:48895257-48895279 GTGAGGCTCTGAGAAGGAGCTGG - Intergenic
950250243 3:11458962-11458984 GTTAGAATCTCATAAGCTGCGGG - Intronic
951011187 3:17681968-17681990 GTTAGATTCTCATAAGGTGCAGG - Intronic
952127974 3:30324432-30324454 CTAAGATTCTCAGAGGTAGCAGG + Intergenic
953861592 3:46548838-46548860 ATTAGATTCTCATAAGCAGTGGG + Intronic
955291995 3:57700803-57700825 ATTAGATTCTCCTAAGGAGCAGG + Intergenic
955572810 3:60326360-60326382 ATTAGGTTCTCATAAGGAGCGGG + Intronic
955698881 3:61663757-61663779 ATTAGAGCCTCATAAGGAGCGGG + Intronic
956287289 3:67624083-67624105 ATTAGATCCTTAGAAGGAGCAGG - Intronic
956338215 3:68189167-68189189 GGTAGATGCTCAGTAGGTGCTGG + Intronic
956438668 3:69259171-69259193 ACTAGATTCTCAAAAGGAGTAGG + Intronic
956727492 3:72168448-72168470 ATTAGATTGTCATAAGGAGCGGG - Intergenic
956932244 3:74057386-74057408 GGAAAATTGTCAGAAGGAGCAGG - Intergenic
957212787 3:77281806-77281828 AGTAGATTCTCATAAGGAGCAGG + Intronic
957377070 3:79371965-79371987 ATTAGATTCTCATAGGGAGCAGG + Intronic
959638638 3:108605565-108605587 ATTAGATTCTCACAAGGAGTGGG + Intronic
961230536 3:125303564-125303586 ATTAGGTTCTCATAAGGAGCAGG - Intronic
961606149 3:128096853-128096875 GTTTTGTTATCAGAAGGAGCTGG + Intronic
962361228 3:134744359-134744381 TTTAGATTCTCAGAAGGATGTGG + Intronic
962489961 3:135883572-135883594 GTGGCAGTCTCAGAAGGAGCGGG + Intergenic
963080358 3:141386701-141386723 GTTTGATTCTCAGAAGCAGAAGG + Intronic
964014281 3:151927880-151927902 GTTAGACTCTGAAAATGAGCAGG + Intergenic
965140961 3:164834116-164834138 GTGAGTTTCACAGCAGGAGCAGG + Intergenic
965724905 3:171704902-171704924 GTTAGACTCTCATAAGGAGCGGG + Intronic
965748758 3:171954898-171954920 CTCAGATTCTCAAAATGAGCAGG - Intergenic
966158679 3:176945775-176945797 GTTAGATTCTCATAAGGAGCGGG - Intergenic
966244884 3:177796336-177796358 GTTCTATTCTCAGAAGCAGACGG - Intergenic
966284060 3:178272207-178272229 GAAAGATTGACAGAAGGAGCTGG + Intergenic
966363418 3:179154399-179154421 ATTAGATTCTCATTAGGAGCAGG - Intronic
966556817 3:181271656-181271678 ATTAGATCCCCATAAGGAGCAGG - Intergenic
966859001 3:184218086-184218108 GTTAGATTCTCATGAGGAGCAGG - Intronic
966939567 3:184737055-184737077 GTGGGCTTCTCAGAAGGACCTGG - Intergenic
967208673 3:187147637-187147659 ATTAGATTACCATAAGGAGCGGG + Intronic
967269641 3:187722409-187722431 GGTAGATTCTGAGAAGGGGCTGG + Exonic
968034532 3:195535165-195535187 ATTAGACTCTCATAAGGAGTGGG + Intronic
970392284 4:15625678-15625700 GTGAAATTCTCAGAAGAAACAGG + Exonic
971541095 4:27817624-27817646 ATTAGATTTTCATAAGGAACAGG - Intergenic
972368645 4:38399823-38399845 ATTAGATTCTCACAAGGAGCAGG - Intergenic
972660468 4:41111040-41111062 ATTAGATTCTCATAACGAGTGGG + Intronic
973829844 4:54747626-54747648 ATTAGATTCTCATAAGAAGTGGG + Intergenic
974354484 4:60794705-60794727 GTTAAACTCTCACAAGGAGCGGG - Intergenic
974401723 4:61416976-61416998 ATTAGATTCTCATAAGAAACAGG + Intronic
976508501 4:85879893-85879915 ATTAGATTCTCATAAGGAGCAGG + Intronic
976705605 4:88016012-88016034 GTGAGATTCTCATAAGGAGCAGG + Intronic
977810539 4:101350270-101350292 ATTAGATTCTCATAAGGAGCGGG + Intergenic
977817490 4:101431735-101431757 GTTATATTCTCATAAGGAGTGGG + Intronic
977910134 4:102524748-102524770 GTTAGATTCTCATAAGGAGCGGG + Intronic
978754496 4:112287301-112287323 ATTAGATTCTCATAAGAAGCGGG + Intronic
979055147 4:115984174-115984196 ATTAGATTCTCATAAGGTGTGGG - Intergenic
979351146 4:119645955-119645977 GTTAGATTCTTATAAGGAATGGG - Intergenic
979478257 4:121183766-121183788 ATTAGATTCTCATAAGGAGCAGG - Intronic
979952172 4:126906771-126906793 GTGAGATTCTCCTAAGGTGCAGG - Intergenic
980070115 4:128234900-128234922 GTAAGATTCTGGGAAGGAGACGG + Intergenic
980784820 4:137538499-137538521 GTTAAATTCACAGAAAGAGAAGG + Intergenic
982931935 4:161419571-161419593 ATTAGATTCTCAGAACAAGGGGG - Intronic
983700114 4:170581480-170581502 GTTAGATTCTCATAAGGAGCAGG + Intergenic
983880962 4:172932004-172932026 TTTCGATTCTCAGCAGTAGCAGG - Intronic
984079817 4:175233422-175233444 ATTAGATTCTCATAAGGAGCGGG - Intergenic
984123131 4:175770947-175770969 GTTTTATTCTCAGAAGGTGCAGG - Intronic
984225301 4:177027724-177027746 CTTAGCTTCTCAGAATCAGCAGG + Intergenic
985778147 5:1856162-1856184 CCTGGATTCTCAGGAGGAGCAGG + Intergenic
986021421 5:3807605-3807627 ATTAGATTCTCCTAAGGAGTGGG - Intergenic
986293374 5:6417991-6418013 ATTAGATTCTCATTAGGAGCTGG - Intergenic
987115413 5:14722778-14722800 GGAAGTTCCTCAGAAGGAGCAGG - Intronic
987835163 5:23151104-23151126 ATTAGATTATTATAAGGAGCGGG - Intergenic
990397198 5:55394511-55394533 CTTAGATTCTCATAACGACCAGG + Intronic
991316170 5:65309323-65309345 ATTAGATTCTCAGAAAGAGTGGG + Intronic
992096375 5:73366641-73366663 GTTAGATTCTCATAAGGAGCAGG + Intergenic
992151207 5:73905218-73905240 ATTAGATTCTCATAAGGAGGGGG - Intronic
992770650 5:80044100-80044122 GAAAGAATATCAGAAGGAGCTGG - Intronic
993935014 5:93988397-93988419 TTTATATTCTCAGAAGTGGCAGG + Intronic
994841717 5:104932497-104932519 GTTCGATTCTCATGAGGAGCAGG + Intergenic
996236398 5:121135911-121135933 TCTAGATTCTGAGATGGAGCAGG - Intergenic
996614356 5:125422631-125422653 TTTAGATTCTCACAAGGAGCAGG - Intergenic
996840755 5:127845056-127845078 CTGAGATACTAAGAAGGAGCTGG + Intergenic
997272672 5:132555003-132555025 ATTAGATTCTCATAAGGAATGGG + Intronic
997693868 5:135846158-135846180 ATCAGATTCTCATAAAGAGCGGG - Intronic
997959431 5:138307956-138307978 CTCAGATTCTCACAAGGAACCGG + Intronic
998692494 5:144602407-144602429 GTTAGAATCTAAGAAGCACCAGG + Intergenic
999395110 5:151222327-151222349 GTAAGTCTCTCAGAAGGAGCAGG + Intronic
1000308759 5:160020699-160020721 ATTAGATTCTTGTAAGGAGCAGG - Intronic
1001842999 5:174895430-174895452 ATTAGATTCTAAGAAGGTGCAGG + Intergenic
1001910810 5:175515953-175515975 ACTAGATTCTCATAAGGAGCGGG + Intronic
1002559676 5:180072632-180072654 GTTAGATTCTCGTAAGAAGTGGG + Intergenic
1004148460 6:13091738-13091760 ATTAGATTCTCATAAGAAGCGGG + Intronic
1004790794 6:19024029-19024051 ATTAGATTCTCATAAAGAGCAGG - Intergenic
1004875193 6:19944356-19944378 GTTAGATTCTCATAAGGAGCAGG + Intergenic
1005450058 6:25963425-25963447 GCTAGGTTCTCAGAAGAGGCAGG + Intronic
1005638952 6:27776546-27776568 ATTAGATTCTCATAAAGAGTGGG + Intergenic
1007141981 6:39585273-39585295 ATTAGATTCTCATAAGGAGCGGG + Intronic
1009565707 6:65308953-65308975 TTTAAATTCTCAGGAGGATCGGG + Intronic
1010040984 6:71383529-71383551 GTTACATTCTCTTAAGGAGCGGG + Intergenic
1012609997 6:101205570-101205592 GTGAAATTTTCAGAAGGAGTTGG + Intergenic
1013227082 6:108127580-108127602 ATTAGATTCTCATAAGGAGCGGG + Intronic
1013355928 6:109346018-109346040 GCTAGATTCTCATAAGGAGCAGG - Intergenic
1014108925 6:117598566-117598588 ATTAGACTCTCACAAGAAGCTGG + Intronic
1014474672 6:121857848-121857870 GTTAGATTCTCATAAGAAGCAGG - Intergenic
1015593472 6:134844084-134844106 ATTAGATTCCTATAAGGAGCAGG + Intergenic
1016462847 6:144296322-144296344 ATTAGATTCTCATAAGGAGCAGG - Intronic
1017375629 6:153764495-153764517 TTTAGAGGCTCAGAAGGAGCAGG + Intergenic
1019015412 6:168876511-168876533 GTTACAACCTCAGCAGGAGCAGG - Intergenic
1019325885 7:438070-438092 GTGTGATTCTCAGAAGGAACTGG - Intergenic
1022114588 7:27250974-27250996 GTGATATTCTGAGCAGGAGCAGG + Intergenic
1022963924 7:35455473-35455495 ATCAGATTCTCAAAAGGACCTGG - Intergenic
1023327003 7:39071217-39071239 ATTAGATTCTCACAAGGAATGGG + Intronic
1024393501 7:48840976-48840998 ATTAGATTCTCATAAGGCTCAGG - Intergenic
1025625573 7:63218371-63218393 ATTAGACTCTCATAAGGAGTAGG + Intergenic
1025656533 7:63524758-63524780 ATTAGACTCTCATAAGGAGTAGG - Intergenic
1026260130 7:68747856-68747878 ATTAGATTTTCATAAGGAGCCGG + Intergenic
1027426654 7:78068171-78068193 ATTACATGCTCATAAGGAGCAGG + Intronic
1027866968 7:83660715-83660737 GTTAGACTCTCAGCAGGATAAGG - Intergenic
1030290249 7:107864920-107864942 GTGAGATTTGCAGGAGGAGCCGG + Intergenic
1030291872 7:107880801-107880823 GCTAGATTCTCATAAGGAACAGG + Intergenic
1032073413 7:128823969-128823991 ATTAGATTCTCATAAGGAGCAGG - Intergenic
1032795591 7:135273644-135273666 ATTAGATTCTCATAAGGAGCAGG + Intergenic
1033397147 7:140986048-140986070 ATCAGATTCTCACAAAGAGCAGG - Intergenic
1033506453 7:142007310-142007332 TTTATATCCTCAAAAGGAGCTGG + Intronic
1034319635 7:150168377-150168399 ATTAGATTCTCATAAGGATCAGG - Intergenic
1034773121 7:153798842-153798864 ATTAGATTCTCATAAGGATCAGG + Intergenic
1035015040 7:155758419-155758441 ATTAGAGTCTTATAAGGAGCTGG + Intronic
1037293745 8:17379373-17379395 GTTAGCTTTTCAGAAGCAACTGG + Intronic
1037485448 8:19342643-19342665 GTTTGATTCACAGGGGGAGCTGG + Intronic
1038195046 8:25359658-25359680 GTGAGATTCACATAAGGAGCTGG - Intronic
1039129706 8:34249056-34249078 GATAGATTCTCAGAATCAGTAGG - Intergenic
1039757203 8:40536433-40536455 TTTATTTTCTCAGAAGGTGCTGG - Intronic
1040905290 8:52463586-52463608 GTTAGATTATCTTAAGGAGCAGG + Intergenic
1040907475 8:52483512-52483534 ATTAGATTCTCATAAGAAGCAGG + Intergenic
1043347569 8:79317573-79317595 GTTTGATTCTCAGGATGAGATGG - Intergenic
1044524386 8:93235379-93235401 ATTAGATTACCTGAAGGAGCTGG + Intergenic
1044942677 8:97359618-97359640 GATACATTCTCAGAAGGCCCAGG - Intergenic
1046870655 8:119202531-119202553 ATTAGAGTCTCAGAAGGAGAAGG - Intronic
1047633818 8:126737491-126737513 TTTAGAGACTCAGAAGGAGAAGG - Intergenic
1048224594 8:132572886-132572908 GTTAGATTGTCTGAAGCAGGAGG - Intronic
1048779413 8:137985292-137985314 ATTAGATTCTCATAAGGAGTGGG - Intergenic
1048802128 8:138203895-138203917 ATTAGATTCTCATAAGGAATGGG + Intronic
1049055303 8:140231825-140231847 GTAAGATTTACAGAAGGGGCAGG - Intronic
1049055548 8:140233805-140233827 GTAAGATTTACAGAAGGGGCAGG - Intronic
1050057044 9:1666571-1666593 ATTAGATTCTCACAGGGAGCAGG - Intergenic
1050712061 9:8476230-8476252 ATTAGATTCTCATAAAGAGCCGG + Intronic
1050871151 9:10571770-10571792 ACTAGATTCTCATAAGGAACAGG + Intronic
1055374664 9:75636041-75636063 ATTACATTCTCATAAGGAGCAGG - Intergenic
1056253209 9:84771970-84771992 GATAGAGTAGCAGAAGGAGCAGG + Intronic
1056273591 9:84971022-84971044 CTTACATTGTCAAAAGGAGCAGG + Intronic
1056751660 9:89356225-89356247 GTTAGATTCTCATAAGGAGCAGG - Intronic
1056958046 9:91098369-91098391 GACAGAATCTCAGAATGAGCTGG + Intergenic
1056992842 9:91426521-91426543 GTAAGGTTCTCAGGAGGAGGAGG + Intergenic
1057557401 9:96098917-96098939 GTTAGCTTGGCTGAAGGAGCAGG - Intergenic
1058646117 9:107132856-107132878 ATAAGATTCTCATAATGAGCAGG - Intergenic
1060333941 9:122704086-122704108 ATTAGATTCTCATAAGGAGCAGG - Intergenic
1060344694 9:122805982-122806004 ATTAGATTCTCATAAGGAGCAGG - Intronic
1203491274 Un_GL000224v1:107735-107757 ATTAGATTCTCATAAGGAGCAGG - Intergenic
1203503898 Un_KI270741v1:49605-49627 ATTAGATTCTCATAAGGAGCAGG - Intergenic
1185891003 X:3822088-3822110 GTGAGATGCTGAGAAGGAACTGG - Intronic
1185896109 X:3860501-3860523 GTGAGATGCTGAGAAGGAACTGG - Intergenic
1185901228 X:3898927-3898949 GTGAGATGCTGAGAAGGAACTGG - Intergenic
1185906342 X:3937365-3937387 GTGAGATGCTGAGAAGGAACTGG - Intergenic
1186079903 X:5919697-5919719 ATTAGATTCTCATAAGGAGCAGG - Intronic
1186565143 X:10654490-10654512 GTTAGATTACCATAAGGAGTGGG + Intronic
1189115173 X:38334964-38334986 GTTAGAGTCTCATAACGAACGGG - Intronic
1189641939 X:43082075-43082097 ATTAGATTCTAATAAAGAGCAGG - Intergenic
1191015356 X:55804159-55804181 TTTACATTCTCAGTTGGAGCGGG + Intergenic
1191648958 X:63515412-63515434 TTTAGCTTCTCAAAAGGAACTGG - Intergenic
1198038328 X:132823432-132823454 TTTAGAGACTCAGAAGGAGGAGG - Intronic
1199778395 X:151035836-151035858 GTTAGACTCTCAGTAGGTGGTGG + Intergenic
1199875596 X:151925473-151925495 GCCAGATTCTCAGAGGGAGAGGG + Intergenic
1200330435 X:155291139-155291161 GTTAGATTCTCAGAATGCCCAGG - Intronic