ID: 1091937902

View in Genome Browser
Species Human (GRCh38)
Location 12:4447887-4447909
Sequence TATGCTGGTGGTCCTCACTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 89}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091937902 Original CRISPR TATGCTGGTGGTCCTCACTT AGG Intergenic
900712506 1:4123213-4123235 GATCCTGGTGGCCCTCACTAAGG - Intergenic
901161424 1:7179021-7179043 GGTACTGGTGTTCCTCACTTAGG - Intronic
902160568 1:14527119-14527141 CATCTGGGTGGTCCTCACTTGGG + Intergenic
902561482 1:17280287-17280309 TAAGCAGGTGGTCCTCACGTTGG + Intronic
908724407 1:67159631-67159653 CATGCTTGTGGTCCCTACTTGGG + Intronic
920575705 1:207058753-207058775 TATGCCTGTAATCCTCACTTTGG - Intronic
922225626 1:223643721-223643743 TCTGCTAGCTGTCCTCACTTTGG - Intronic
1064669380 10:17694497-17694519 TATGGTGATGGTCTGCACTTGGG + Intronic
1068039623 10:51807616-51807638 CTTGCTGGTTTTCCTCACTTAGG - Intronic
1068460776 10:57325292-57325314 TATGCTGATGATGCTCACTTAGG - Intergenic
1073225936 10:101919083-101919105 TCTGCTGAGGGTCCTCCCTTTGG - Intronic
1075927473 10:126264522-126264544 TATGCTGGTGGATTTCACTGTGG - Intronic
1077822926 11:5768151-5768173 TATGCTGGTGGTACCCACTATGG - Intronic
1080222704 11:29924454-29924476 CATCCTGGTGGTTCTTACTTAGG - Intergenic
1084396966 11:68917834-68917856 TATGCTCGAGAGCCTCACTTCGG + Exonic
1091701303 12:2665166-2665188 GATGCTGGTGGAGCTCACTCTGG - Intronic
1091937902 12:4447887-4447909 TATGCTGGTGGTCCTCACTTAGG + Intergenic
1092661855 12:10747508-10747530 TTTGCTGGAGGTCCACACCTGGG + Intergenic
1093958013 12:25244582-25244604 TCTGCTGCTGGTCTTTACTTTGG + Intronic
1094345821 12:29467760-29467782 GATGGTGGTGTTCCACACTTAGG - Intronic
1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG + Intronic
1095658518 12:44700088-44700110 GATGTTGGTGCTGCTCACTTAGG - Intronic
1096651611 12:53064687-53064709 TGTGCTGCTGGGCCTCCCTTTGG - Exonic
1097588631 12:61545638-61545660 TGGTCTTGTGGTCCTCACTTGGG - Intergenic
1106593796 13:31120240-31120262 CATGGTGGGGGTGCTCACTTGGG + Intergenic
1107517205 13:41141741-41141763 TATGGTGGGGATACTCACTTTGG - Intergenic
1113597234 13:111541891-111541913 GATGCTGGCTGTCCTCACTAAGG + Intergenic
1113638818 13:111942825-111942847 TATGCCAGTGGTTCTCAATTGGG - Intergenic
1120743683 14:88134728-88134750 TCTGCTCATTGTCCTCACTTGGG + Intergenic
1120825685 14:88952882-88952904 TCTTCTGATGGTCCACACTTAGG - Intergenic
1121600989 14:95202876-95202898 TTTGCTGGTGGTCCTCATGGGGG + Exonic
1136650521 16:31665892-31665914 CATGCTGGCGGTACTCACTGTGG + Intergenic
1148075393 17:44932676-44932698 TCTGGTGGTGGTCCCGACTTGGG + Exonic
1158918455 18:62161332-62161354 TATGCTGCTGTTCTTTACTTTGG - Exonic
1162733589 19:12733615-12733637 TAAACTGGTGGTTCTCAATTGGG - Intronic
1163156895 19:15444582-15444604 TATCCTGGTGGTTCTCAAATGGG - Intronic
1166138923 19:40795249-40795271 TAGGTTAGTGGTTCTCACTTTGG - Intronic
1168623929 19:57901763-57901785 TATGATGGTGGTACTTACTGTGG + Intronic
925931144 2:8709181-8709203 TCAGCTGGTGGGCCTCACTGAGG + Intergenic
927687758 2:25183885-25183907 TCTGATGGTGATCCACACTTTGG + Intergenic
931503658 2:62899635-62899657 TATGCTGGAGTTCCACACTGAGG + Intronic
935309182 2:101766291-101766313 TAAGCTGGTGGTGGTCACCTGGG + Intronic
935722570 2:105992439-105992461 CATGCTGGTGGTACTCACCATGG + Intergenic
936377283 2:111952720-111952742 AATACTGGTGGTGCTCGCTTTGG - Intronic
939028066 2:137038122-137038144 TATGGTGGTAGTTATCACTTGGG + Intronic
942479175 2:176364245-176364267 TATACCAGTGGTCCTCAATTAGG - Intergenic
943030386 2:182678977-182678999 TATGCTAATTATCCTCACTTTGG + Intergenic
1169440052 20:5626418-5626440 TATACTATGGGTCCTCACTTTGG - Intergenic
1169660081 20:7968987-7969009 TACACTGGTGGTTCTCAATTGGG - Intergenic
1169789810 20:9397885-9397907 TAGGTTGGTGGTTCTCCCTTGGG + Intronic
1175356158 20:58370087-58370109 TATGCAGGTGCCTCTCACTTGGG + Intergenic
1175413229 20:58785109-58785131 GATGCTGGTGGGCCTCGCCTGGG + Intergenic
1175621155 20:60448666-60448688 TCTCCAGGTGTTCCTCACTTGGG - Intergenic
1177820081 21:26021889-26021911 AATGCTGGTGGTTCTCTCTGTGG + Exonic
1180908030 22:19429510-19429532 TATGCTTGTGATACTCAGTTGGG - Intronic
1181575709 22:23793209-23793231 TATTCTCTTGGTCCTCACTCAGG - Intronic
1181920737 22:26318439-26318461 CAAACTGGTGGTCCTCAGTTTGG - Intronic
951629537 3:24704337-24704359 TAGATTGGTGGTCCTCAGTTGGG - Intergenic
956379589 3:68651612-68651634 TATACTGGTGGTCACCACATTGG - Intergenic
956647772 3:71473710-71473732 TAAACTGGTGATCCTCAATTGGG + Intronic
957910329 3:86612899-86612921 TATGCAGGTGGTCCTCAAAAAGG + Intergenic
958499973 3:94892946-94892968 TATACTGCAGGTCCTCACTTGGG - Intergenic
959196396 3:103188263-103188285 TATTCTGGTGGAGCTCTCTTTGG + Intergenic
960592167 3:119377000-119377022 AATGCTGGTGTTCATCACTATGG + Intronic
965808185 3:172564585-172564607 TTTGCTGGTGTTGCTGACTTTGG - Intergenic
966287893 3:178319233-178319255 TAGTCTGGTGTTCCTCATTTAGG + Intergenic
967846879 3:194051277-194051299 TATGCTTCTGGTCTGCACTTTGG + Intergenic
971143617 4:23951587-23951609 TATCCTGCTGTTCCTCATTTGGG - Intergenic
973120014 4:46510584-46510606 TTAGATGTTGGTCCTCACTTAGG - Intergenic
973216746 4:47677884-47677906 TTTACTGGTGGTCCTCTCCTTGG - Intronic
985556166 5:558998-559020 TTTTCTGGTGGTCCTCACGGAGG + Intergenic
985556205 5:559144-559166 TTTTCTGGTGGTCCTCACGGAGG + Intergenic
988241510 5:28615097-28615119 TATGCTGGTGCTCTCCACTGAGG - Intergenic
989242027 5:39212684-39212706 TATAATGGTGCTCTTCACTTTGG + Intronic
992668123 5:79031544-79031566 TATGCTGTTGGTCCACACCTGGG + Intronic
993711201 5:91227155-91227177 TATGCTGGTGATCCTCAACCTGG + Intergenic
999290254 5:150420444-150420466 TATCTTTGTGGTCCACACTTTGG - Intergenic
1002915765 6:1526501-1526523 TATTCAGGTGTTCCTCACTCAGG - Intergenic
1004326144 6:14675632-14675654 TCAGCAGCTGGTCCTCACTTTGG + Intergenic
1006314512 6:33282279-33282301 TATCCAGCTGGTCCTCTCTTGGG - Intronic
1006897836 6:37482137-37482159 TTTGCTGGACTTCCTCACTTTGG + Intronic
1012918353 6:105195407-105195429 CATGCTTGTGGTCCCTACTTGGG + Intergenic
1015012931 6:128374353-128374375 TATGCTGGGGATACACACTTTGG - Intronic
1015630140 6:135223678-135223700 TTTGCTGCTCCTCCTCACTTTGG + Intergenic
1022544034 7:31168731-31168753 TATGCTGGTAGTCATCATGTTGG + Intergenic
1030056969 7:105591655-105591677 TATGCTGGTGGTCCACACATAGG - Intronic
1037659179 8:20912458-20912480 GATGCTGGTGGTTCTCAGATTGG + Intergenic
1037903699 8:22703183-22703205 TATGCTACTGGTACTCAGTTGGG + Intergenic
1046088135 8:109464558-109464580 GTTGCTGGTGGCACTCACTTTGG + Exonic
1055392066 9:75833638-75833660 GAGGCTGGTGGTCCTCAAATTGG - Intergenic
1056379481 9:86044224-86044246 TATGCCAGTGGTTCTCACGTGGG - Intronic
1060960357 9:127676451-127676473 GCTGCTGATGGTCCTCACTCAGG + Intronic
1061058229 9:128236043-128236065 TATCCTTGTGGTCCTCTCTTTGG + Intronic
1185709942 X:2295980-2296002 GATGCTTGTGTGCCTCACTTGGG + Intronic
1194334684 X:92630533-92630555 CATTCTGGTGGTGATCACTTAGG + Intergenic
1200643162 Y:5747586-5747608 CATTCTGGTGGTGATCACTTAGG + Intergenic
1202115941 Y:21468819-21468841 TCTGCTGCTGGGCCTCACTGAGG - Intergenic