ID: 1091942362

View in Genome Browser
Species Human (GRCh38)
Location 12:4499485-4499507
Sequence CTTCTAACCAGTTTCTATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 5, 3: 12, 4: 249}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091942359_1091942362 30 Left 1091942359 12:4499432-4499454 CCAGACTATGTAAAGCTGAATTT 0: 1
1: 0
2: 2
3: 13
4: 179
Right 1091942362 12:4499485-4499507 CTTCTAACCAGTTTCTATGTGGG 0: 1
1: 0
2: 5
3: 12
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091942362 Original CRISPR CTTCTAACCAGTTTCTATGT GGG Intronic
908411644 1:63871792-63871814 ATTCCAACCAGCTTCCATGTTGG - Intronic
913162881 1:116161299-116161321 CTTGTAGCCACTTTATATGTAGG - Intergenic
913930059 1:124947157-124947179 CTTCTGCCTAGTTTTTATGTGGG + Intergenic
914343398 1:146778490-146778512 TTTCAAAGCAGTTTCTATGGTGG - Intergenic
914772460 1:150701264-150701286 ATCCTAGCCAGTTTATATGTAGG - Intronic
915914673 1:159933838-159933860 CTTCTTACCAGGTGCTGTGTGGG - Intronic
921326280 1:213988655-213988677 CCTCTAAACAGTTTCTAAGCGGG + Intronic
923952502 1:238974213-238974235 CTTCTAACAAGTTTTCATTTAGG + Intergenic
1063233019 10:4084821-4084843 CTTCTCACCGGTTCCTTTGTAGG - Intergenic
1063389465 10:5639965-5639987 CTTGTAAAAAGTTTATATGTAGG - Exonic
1063990300 10:11554192-11554214 CCTCTGAGCAGTTTCTATTTGGG - Intronic
1066785861 10:39003554-39003576 CTTCTTTCTAGTTTCTATCTGGG + Intergenic
1066786893 10:39014342-39014364 CTTCTTTCCAGTTTTTATCTGGG + Intergenic
1066790572 10:39058139-39058161 CTTCTTTCCAGTTTCTACCTGGG - Intergenic
1066791609 10:39070774-39070796 CTTCTTACTAGTTTTTATCTGGG - Intergenic
1066793023 10:39087056-39087078 CTTCTTTCTAGTTTCTATCTGGG - Intergenic
1066793120 10:39088203-39088225 CTTCTTTCCAGTTTTTATCTGGG - Intergenic
1066796037 10:39122037-39122059 CTTCTATCAAGTTTTTATCTGGG - Intergenic
1066796278 10:39124938-39124960 CTTCTTTCCAGTTTTTATATGGG - Intergenic
1066797593 10:39140152-39140174 CTTCTTTCCAGTTTTTATCTGGG - Intergenic
1066927785 10:41719401-41719423 CTTCTTTCCAGTTTTTATCTGGG - Intergenic
1066929184 10:41735374-41735396 CTTCTTTCCAGTTTCTATGTGGG - Intergenic
1067950407 10:50731244-50731266 CTTCTTACCAGGCTCTTTGTGGG + Intergenic
1070267747 10:74920783-74920805 ATTATAACAAGTTTCTTTGTTGG - Intronic
1072389841 10:94971989-94972011 GTACTTTCCAGTTTCTATGTTGG + Intronic
1078996349 11:16704721-16704743 ATTCTACCCAGTTTATAGGTGGG + Intronic
1079919521 11:26415134-26415156 CTTCTAAAGAGATTCTAGGTAGG - Intronic
1082265885 11:50117856-50117878 CTTCTTTCCAGTTTCTATCTGGG + Intergenic
1082269578 11:50155341-50155363 CTTCTAAACAATATCTGTGTTGG + Intergenic
1082290203 11:50360716-50360738 CTTCTTTCCAGTTTCTATCTGGG - Intergenic
1090187741 11:124749307-124749329 CTTTTAACCAGTTTCTTTGGAGG - Intronic
1091662787 12:2397001-2397023 CTTCTAAATAGTTTATATTTGGG + Intronic
1091942362 12:4499485-4499507 CTTCTAACCAGTTTCTATGTGGG + Intronic
1092994990 12:13941262-13941284 CTTTTGACCAGGTTCAATGTGGG - Intronic
1093523163 12:20073676-20073698 CTTGAAACCACTTGCTATGTGGG - Intergenic
1093797395 12:23329038-23329060 CTACTAGCCAGTTTCAAAGTTGG + Intergenic
1093911886 12:24757673-24757695 CTCCTAACTTGTTTCTATATTGG + Intergenic
1095080131 12:37989806-37989828 CTTCTTTCCAGTTTTTATCTGGG - Intergenic
1095080263 12:37991511-37991533 CTTCTTACTAGTTTTTATCTGGG - Intergenic
1095081071 12:38000224-38000246 CTTCTTTCTAGTTTTTATGTGGG - Intergenic
1098444644 12:70553630-70553652 CTGCAAACCAGTTTTGATGTTGG + Intronic
1098509837 12:71298909-71298931 CTTCAAACCACTTTCTAATTAGG - Intronic
1099043125 12:77680610-77680632 CTTTTATCCTGTTTCTCTGTTGG + Intergenic
1099638492 12:85250220-85250242 CTTCTACCCTGCTTCTTTGTCGG - Intronic
1099842662 12:87985708-87985730 CCTCTCACTAGTTTCTATGGTGG + Intronic
1105621396 13:22070818-22070840 CTTCTATCCAGTGTCACTGTGGG + Intergenic
1106359512 13:29017645-29017667 CGTCTAACCAGTTGCTCAGTTGG + Intronic
1110519960 13:76464237-76464259 CTTCTATCCAGTGCTTATGTGGG + Intergenic
1113076845 13:106475302-106475324 CTTCTAACAAGTTGCCAGGTTGG - Intergenic
1115900109 14:38136770-38136792 CTTGTACCCCATTTCTATGTTGG + Intergenic
1119797333 14:77410679-77410701 CTTCTGACCATTTTTTCTGTTGG - Intronic
1130247897 15:82270076-82270098 CTTCATACCAGTATCTATGATGG - Intronic
1130555797 15:84921641-84921663 CTTCTAACCAGTGTGTCTCTTGG - Intronic
1131896449 15:97036239-97036261 CATTTAAACAGTTTCTATTTTGG + Intergenic
1136741905 16:32540983-32541005 CTTCCTACCAGTTTTTATTTTGG - Intergenic
1136742419 16:32549036-32549058 CTTCTTTCTAGTTTTTATGTGGG - Intergenic
1136744063 16:32567785-32567807 CTTCTATCCAGTTTTTATGTAGG - Intergenic
1136744628 16:32574697-32574719 CTTCTATCTAGTTTTTATGTGGG - Intergenic
1136865023 16:33741556-33741578 CTTCTTCCCAATTTCAATGTAGG + Intergenic
1136865155 16:33743431-33743453 CTTCTTCCCAATTTCAATGTAGG + Intergenic
1137078261 16:36005092-36005114 CTTCTGTCTAGTTTTTATGTGGG - Intergenic
1137078291 16:36005604-36005626 CTTCTGTCTAGTTTTTATGTGGG - Intergenic
1137078415 16:36007820-36007842 CTTCTGTCTAGTTTTTATGTGGG - Intergenic
1137976496 16:53036645-53036667 CTTGGAACCACTTGCTATGTGGG + Intergenic
1138212594 16:55175831-55175853 CTACTAACCAGGTTCTCTGCTGG + Intergenic
1139046507 16:63066579-63066601 CTTCTTGCCATTTTCTATTTTGG - Intergenic
1139990591 16:70936843-70936865 TTTCAAAGCAGTTTCTATGGTGG + Intronic
1203024969 16_KI270728v1_random:500533-500555 CTTCTATCTAGTTTTTATGTGGG + Intergenic
1203025535 16_KI270728v1_random:507448-507470 CTTCTATCCAGTTTTTATGTAGG + Intergenic
1203027180 16_KI270728v1_random:526192-526214 CTTCTTTCTAGTTTTTATGTGGG + Intergenic
1203027698 16_KI270728v1_random:534251-534273 CTTCCTACCAGTTTTTATTTTGG + Intergenic
1203044023 16_KI270728v1_random:800180-800202 CTTCCTACCAGTTTTTATTTTGG - Intergenic
1203044541 16_KI270728v1_random:808239-808261 CTTCTTTCTAGTTTTTATGTGGG - Intergenic
1203046186 16_KI270728v1_random:826983-827005 CTTCTATCCAGTTTTTATGTAGG - Intergenic
1203046752 16_KI270728v1_random:833898-833920 CTTCTATCTAGTTTTTATGTGGG - Intergenic
1203126521 16_KI270728v1_random:1589699-1589721 CTTCTTCCCAATTTCAATGTAGG + Intergenic
1143415786 17:6748847-6748869 CTTCTCACCAGATACTATGGAGG + Intergenic
1144517174 17:15926708-15926730 TTTCTAAACAGTTTTTTTGTTGG + Intergenic
1144841276 17:18187715-18187737 CTTCTTACCAGTTTATATGCAGG - Intronic
1147918874 17:43904422-43904444 CTTCTTACCAGTTTCAGAGTTGG + Exonic
1155752164 18:29438967-29438989 CTTTTTAGCAGTTTCTTTGTTGG + Intergenic
1156663543 18:39377814-39377836 GTTTCAACCAATTTCTATGTTGG + Intergenic
1156734378 18:40235519-40235541 TTTCTAACTAGCTTCCATGTAGG + Intergenic
1157058880 18:44262941-44262963 CTTCTTACTAGCTTCTATGATGG + Intergenic
1157187282 18:45551499-45551521 CTTCTGACCAGGTTCTGTCTGGG + Intronic
1164369338 19:27629146-27629168 CTTCTTTCCAGTTTTTATCTGGG - Intergenic
1164928217 19:32148276-32148298 CTTATAAACAGCTTCTAGGTGGG - Intergenic
926378183 2:12255904-12255926 CTTCTCACCAATCTGTATGTTGG + Intergenic
929731404 2:44497450-44497472 TTTCTAAACATTTTTTATGTAGG + Intronic
930722644 2:54652838-54652860 CTTCATGCCAGTTTCTGTGTTGG + Intronic
932551823 2:72778259-72778281 CTTCCAACCTATTTCTATCTTGG - Intronic
932804054 2:74767980-74768002 CCACTAACCTGTTTCTATGAGGG - Intergenic
934115188 2:88783128-88783150 CTTCTTCCCAATTTCAATGTAGG - Intergenic
934115436 2:88786865-88786887 CTTCTATCCAAATTCAATGTAGG - Intergenic
934605149 2:95689444-95689466 CTTCTAACCATTTTCTTTTGTGG + Intergenic
934628148 2:95882077-95882099 CTTCTACACAATTTCCATGTAGG + Intronic
934628269 2:95883950-95883972 CTTCTTCCCAATTTCAATGTGGG + Intronic
934628391 2:95885825-95885847 CTTCTTCCCAATTTCAATGTAGG + Intronic
934628516 2:95887701-95887723 CTTCTTCCCAATTTCGATGTGGG + Intronic
934630411 2:95913885-95913907 CTTCTTCCCAGTTTCAATGTGGG + Intronic
934630827 2:95919497-95919519 CTTCTTCCCAATTTCAATGTGGG + Intronic
934631087 2:95923271-95923293 CTTCTTCCCAATTTCAATGTGGG + Intronic
934631461 2:95928847-95928869 CTTCTTCCCAATTTCAATGTAGG + Intronic
934633540 2:95958366-95958388 CTTCTTCCCAATTTCAATGTAGG + Intronic
934799961 2:97144912-97144934 CTTCTTCCCAATTTCAATGTAGG - Intronic
934802697 2:97181985-97182007 CTTCTTCCCAATTTCAATGTGGG - Intronic
934802835 2:97183856-97183878 CTTCTATCCAAATTCAATGTAGG - Intronic
934802958 2:97185712-97185734 CTTCTTCCCAATTTCAATGTGGG - Intronic
934803088 2:97187615-97187637 CTTCTTCCCAATTTCAATGTGGG - Intronic
934803226 2:97189503-97189525 CTTCTTCCCAATTTCAATGTGGG - Intronic
934803497 2:97193254-97193276 CTTCTTCCCAATTTCAATGTGGG - Intronic
934803924 2:97198859-97198881 CTTCTTCCCAATTTCAATGTGGG - Intronic
934804340 2:97204464-97204486 CTTCTTCCCAATTTCAATGTGGG - Intronic
934804615 2:97208207-97208229 CTTCTTCCCAATTTCAATGTGGG - Intronic
934804753 2:97210073-97210095 CTTCTTCCCAATTTCAATGTGGG - Intronic
934805011 2:97213816-97213838 CTTCTTCCCAATTTCAATGTGGG - Intronic
934805134 2:97215698-97215720 CTTCTTCCCAATTTCAATGTAGG - Intronic
934805258 2:97217575-97217597 CTTCTACACAATTTCCATGTAGG - Intronic
934832101 2:97537943-97537965 CTTCTACACAATTTCAATGTAGG + Intronic
934832225 2:97539809-97539831 CTTCTTCCCAATTTCAATGTGGG + Intronic
934832472 2:97543564-97543586 CTTCTTCCCAATTTCAATGTGGG + Intronic
934832721 2:97547313-97547335 CTTCTTCCCAATTTCAATGTGGG + Intronic
934833118 2:97552933-97552955 CTTCTTCCCAATTTCAATGTGGG + Intronic
934833242 2:97554835-97554857 CTTCTTCCCAATTTCAATGTGGG + Intronic
934833369 2:97556713-97556735 CTTCTATCCAATTTCAATGTAGG + Intronic
935627626 2:105184421-105184443 CTTTTCTCCAGTTTCTATGCAGG - Intergenic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
936538606 2:113331984-113332006 CTTCTAACCATTTTCTTTTGTGG + Intergenic
941427072 2:165360812-165360834 CTTCTAGCCAGTTCATATTTTGG + Intronic
942283891 2:174394759-174394781 ATTTTCACAAGTTTCTATGTAGG + Intronic
942545940 2:177063673-177063695 CTCCAAACCAGTTTCTCTATAGG + Intergenic
943704363 2:191019583-191019605 ATTTTAACCAGCTGCTATGTAGG - Intronic
945450002 2:209983192-209983214 CATAAAACCAGTTTATATGTAGG + Intronic
947869550 2:233426250-233426272 TTTCTAACCAGATTTTATGCAGG + Intronic
1168954573 20:1826064-1826086 CTTCTTGCCAGTTTCTATGTGGG + Intergenic
1170029268 20:11927863-11927885 CTTTTCACCAGTGTTTATGTTGG - Intergenic
1176370827 21:6060560-6060582 CATCTAACCACTTTCTCTCTGGG - Intergenic
1179279491 21:39922401-39922423 CTTCTATTCAGTTTCTGTGGGGG + Intronic
1179287207 21:39987806-39987828 CTTCTAACCATATTTTATCTAGG + Intergenic
1179752692 21:43477981-43478003 CATCTAACCACTTTCTCTCTGGG + Intergenic
1180905371 22:19406861-19406883 CTTTTAACCATTTTGTATATTGG + Intronic
951442983 3:22743777-22743799 ATTTTGACCAGTTTCTATTTTGG - Intergenic
951598274 3:24342181-24342203 TTTTAAACCATTTTCTATGTAGG - Intronic
955140393 3:56262958-56262980 TCTCTGGCCAGTTTCTATGTGGG - Intronic
955834913 3:63044173-63044195 CTTCTGAACTGTTTCTCTGTAGG - Intergenic
957493109 3:80955238-80955260 CTTCTAACTAGTTTTTATTATGG + Intergenic
958209115 3:90445847-90445869 CATCTGTCCAGTTTTTATGTGGG + Intergenic
958968277 3:100582852-100582874 ATACTAACCAGTTTCTCTGATGG + Intergenic
961959209 3:130836589-130836611 CTTCTTTGCAGTTTCTATGATGG + Intergenic
963078735 3:141371829-141371851 CTTCTAACCATTGTTGATGTTGG + Intronic
963665364 3:148178509-148178531 CTTCTATTCACTTTGTATGTGGG + Intergenic
963706595 3:148696236-148696258 CTTCTCACCACTTGCTGTGTGGG - Intergenic
966663265 3:182439911-182439933 CTTCTAATCAGGTCCTCTGTGGG - Intergenic
968329844 3:197858256-197858278 CAGCTAACCAGTTGTTATGTTGG + Intronic
970181752 4:13404849-13404871 ATACTAACCAGTTTTTTTGTTGG + Intronic
970378004 4:15478792-15478814 CTTCTTACCTGTTTCTTTCTTGG - Exonic
970479954 4:16462770-16462792 ATTCTGCCCAGTTTCTATATTGG - Intergenic
976399447 4:84590911-84590933 CTTCGAGCCACTTGCTATGTTGG - Intronic
977125805 4:93166295-93166317 CTTCTACCCACTTTAGATGTTGG - Intronic
978867934 4:113537654-113537676 CTTCTACCCAGTATCTCTCTAGG - Intronic
980314571 4:131180903-131180925 CTTCTCACCATTTTTTCTGTGGG + Intergenic
984027760 4:174565072-174565094 CTCCTGACCACATTCTATGTGGG - Intergenic
987976465 5:25021052-25021074 CTTAAAGCCACTTTCTATGTGGG - Intergenic
989859745 5:46355185-46355207 CTTCTGTCTAGTTTTTATGTGGG + Intergenic
995554704 5:113315487-113315509 ATTCAAACGACTTTCTATGTTGG - Intronic
996711344 5:126546427-126546449 CTTCTGAGCAGTTTCCATGTGGG + Intronic
996983704 5:129533132-129533154 CTTCTGATCAGTTTCTAATTTGG - Intronic
999929785 5:156418685-156418707 CACCTAACCACTTTCTATTTTGG - Intronic
1000023443 5:157338715-157338737 TTGCTTTCCAGTTTCTATGTTGG - Intronic
1010929987 6:81790150-81790172 CTCCAAACCAGTTTCTACCTTGG - Intergenic
1015114832 6:129636503-129636525 CTTTTAACCAGTCTCTATCCTGG - Intronic
1015889947 6:137960486-137960508 CTGCTAACCAGGTACTATGGAGG - Intergenic
1018560162 6:165093681-165093703 CTTCTTTCCATTTTCTTTGTGGG - Intergenic
1018800016 6:167214593-167214615 CCTCTGACCTGCTTCTATGTGGG + Intergenic
1018813001 6:167311290-167311312 CTTCTGACCTGCTTCTAAGTGGG - Intronic
1021066035 7:16173725-16173747 CTTGTAACCATTTTTTCTGTAGG - Intronic
1024052713 7:45639002-45639024 CTTATGACAAGTTTATATGTGGG - Intronic
1025532046 7:61900005-61900027 CTTCTTTCTAGTTTTTATGTGGG - Intergenic
1025532297 7:61903615-61903637 CTTCTATCTAGTTTTTATCTGGG - Intergenic
1025532409 7:61905328-61905350 CTTCTTTCTAGTTTTTATGTGGG - Intergenic
1025533543 7:61920125-61920147 CTTCTATCTAGTTTATATCTGGG - Intergenic
1025534574 7:61931935-61931957 CTTCTTTCTAGTTTCTATCTGGG - Intergenic
1025534585 7:61932107-61932129 CTTCTTTCCAGTTTTTATTTAGG - Intergenic
1025536073 7:61949386-61949408 CTTCTTTCCAGTTTTTATCTGGG + Intergenic
1025536152 7:61950239-61950261 CTTCTTTCTAGTTTTTATGTGGG + Intergenic
1025536762 7:61957744-61957766 CTTCTTTCTAGTTTTTATGTAGG - Intergenic
1026139773 7:67695756-67695778 ATTACAACCAGTTTCTTTGTGGG - Intergenic
1027624953 7:80533327-80533349 CTTACAACCTGTTTCTTTGTTGG - Intronic
1030279951 7:107763265-107763287 CTTGTAATCAGTTTTTATTTAGG + Intergenic
1031654687 7:124339706-124339728 CTGCTAACTAGTTTCAAAGTTGG - Intergenic
1033052472 7:138018567-138018589 CTTATTACCAGATTCTAGGTGGG - Intronic
1034050948 7:147983983-147984005 CTGCTAAGCAGTTTTTTTGTGGG - Intronic
1034292132 7:149941271-149941293 ATGCTGACCAGTTTCTACGTAGG + Intergenic
1039461757 8:37751079-37751101 TTTCTAACCACTTAATATGTGGG + Intronic
1040112402 8:43572539-43572561 CTTCTATCTAGTTTGTATCTGGG - Intergenic
1040113989 8:43593502-43593524 CTTCTTTCTAGTTTTTATGTGGG - Intergenic
1040114261 8:43597080-43597102 CTTCTTTCCAGTTTTTATCTAGG - Intergenic
1040114731 8:43603222-43603244 CTTCTTTCCAGTTTTTATCTGGG - Intergenic
1040115552 8:43614315-43614337 CTTCTTACTAGTTTTTATCTGGG - Intergenic
1040115688 8:43616091-43616113 CTTCTTTCTAGTTTTTATGTGGG - Intergenic
1040117458 8:43639660-43639682 CTTCTATCTAGTTTTTATCTGGG - Intergenic
1040119137 8:43661518-43661540 CTTCTTTCCAGTTTTTATCTAGG - Intergenic
1040119149 8:43661693-43661715 CTTCTTTCTAGTTTCTATCTGGG - Intergenic
1040119382 8:43664951-43664973 CTTCTTTCTAGTTTTTATGTTGG - Intergenic
1040120332 8:43677323-43677345 CTTCTTACTAGTTTTTATCTGGG - Intergenic
1040120684 8:43681776-43681798 CTTCTATCTAGTTTGTATCTGGG - Intergenic
1040120718 8:43682118-43682140 CTTCTTTCTAGTTTCTATCTGGG - Intergenic
1040123904 8:43714221-43714243 CTTCTGTCTAGTTTTTATGTGGG - Intergenic
1040124230 8:43718603-43718625 CTTCTTTCTAGTTTCTATCTGGG - Intergenic
1040124299 8:43719459-43719481 CTTCTTTCTAGTTTTTATGTAGG - Intergenic
1040124309 8:43719632-43719654 CTTCTTTCCAGTCTTTATGTGGG - Intergenic
1040124474 8:43721209-43721231 CTTCTTTCTAGTTTCTATCTGGG - Intergenic
1040125679 8:43734814-43734836 CTTCTATGCAGTTTTTATCTGGG - Intergenic
1040125799 8:43736180-43736202 CTTCTTTCTAGTTTTTATGTGGG - Intergenic
1040126329 8:43741771-43741793 CTTCTTACTAGTTTTTATCTGGG - Intergenic
1040126362 8:43742121-43742143 CTTCTTTCCAGTTTTTATCTGGG - Intergenic
1040127838 8:43758654-43758676 CTTCTTTCCAGTTTTTATCTTGG - Intergenic
1040129044 8:43772923-43772945 CTTCTTTCTAGTTTTTATGTAGG - Intergenic
1040129176 8:43774466-43774488 CTTCTTTCCAGTTTTTATCTTGG - Intergenic
1040131693 8:43804385-43804407 CTTCTTTCCAGTTTTTATCTGGG - Intergenic
1040131720 8:43804729-43804751 CTTCTTTCTAGTTTCTATCTGGG - Intergenic
1040132138 8:43809598-43809620 CTTCTTTCCAGTTTTTATCTGGG - Intergenic
1040132822 8:43817098-43817120 CTTCTTTCCAGTTTTTATCTGGG - Intergenic
1040133213 8:43822065-43822087 CTTCTTTCTAGTTTTTATGTAGG - Intergenic
1040133469 8:43825238-43825260 CTTCTTTCTAGTTTTTATGTGGG - Intergenic
1040135708 8:43851242-43851264 CTTCTTTCTAGTTTCTATATGGG - Intergenic
1040137747 8:43874997-43875019 CTTCTTTCTAGTTTCTATCTGGG - Intergenic
1040137847 8:43876189-43876211 CTTCTTTCCAGTTTTTATCTGGG + Intergenic
1040138872 8:43887003-43887025 CTTCTTTCCAGTTTGTATCTGGG - Intergenic
1040139199 8:43890775-43890797 CTTCTTTCCGGTTTCTATCTGGG - Intergenic
1040274690 8:46002923-46002945 CTTCTTTCTAGTTTCTATCTTGG - Intergenic
1040275137 8:46008957-46008979 CTTCTTTCCAGTTTTTATCTGGG - Intergenic
1040275245 8:46010420-46010442 CTTCTTTCTAGTTTCTATATAGG - Intergenic
1040281480 8:46051532-46051554 CTTCTTTCCAGTTTTTATCTAGG - Intergenic
1040281714 8:46055487-46055509 CTTCTTTCTAGTTTTTATGTAGG - Intergenic
1040281928 8:46059095-46059117 CTTCTTTCTAGTTTTTATGTTGG - Intergenic
1040282962 8:46076678-46076700 CTTCTTTCTAGTTTTTATGTTGG - Intergenic
1040321312 8:46307240-46307262 CTTCTTACCAGTTTCTGTTGTGG + Intergenic
1040327744 8:46364399-46364421 CTTCTTTCCAGTTTTTCTGTGGG + Intergenic
1040348195 8:46532189-46532211 CTTCTTTCCAGTTTTTATCTCGG - Intergenic
1042688250 8:71465310-71465332 CTTTTAACCAATTTCTTTGATGG - Intronic
1042947837 8:74172898-74172920 CTTCTTTCCAGTTGCTATGTTGG + Intergenic
1043154037 8:76755260-76755282 ATTTTACCCAGTTTCTTTGTTGG + Intronic
1044994333 8:97824478-97824500 TTTCTAAGCAGTATTTATGTTGG + Intronic
1046142404 8:110111136-110111158 CTTTCTACCAGTTTCCATGTTGG + Intergenic
1046678188 8:117136219-117136241 CTTAAAACTATTTTCTATGTAGG - Intronic
1046833746 8:118776762-118776784 CTTCTAACCAGCATATCTGTGGG + Intergenic
1047439436 8:124863791-124863813 CTTGTAAACAGGTTCTATCTTGG + Intergenic
1047488744 8:125356700-125356722 CTTTTAAGCTTTTTCTATGTGGG - Intronic
1047912504 8:129545559-129545581 TTTCTAACCAGTATGTTTGTTGG - Intergenic
1052528220 9:29649430-29649452 CTTCTGACCTGATTCAATGTGGG - Intergenic
1052710222 9:32045736-32045758 CTTCTAACCATTTTGAATGTCGG + Intergenic
1203582560 Un_KI270746v1:24919-24941 CTTCTTCCCAATTTCAATGTAGG - Intergenic
1203582831 Un_KI270746v1:28391-28413 CTTCTTCCCAATTTCAATGTGGG - Intergenic
1187522188 X:20023484-20023506 CTACTAATCAGTTTCTTGGTTGG - Intronic
1188145994 X:26614299-26614321 CTTCTAACTAGTTTTTATTATGG + Intergenic
1190782938 X:53615905-53615927 CTTCTTTCCACTTTATATGTTGG - Intronic
1191575212 X:62696163-62696185 CTTCTTTCTAGTTTTTATGTGGG + Intergenic
1191577459 X:62722246-62722268 CTTCTTCCCAGTTTTTATTTGGG + Intergenic
1191577796 X:62725781-62725803 CTTCTTTCCAGTTTTTATCTGGG + Intergenic
1191578448 X:62733345-62733367 CTTCTTTCTAGTTTTTATGTGGG + Intergenic
1191578717 X:62736454-62736476 CTTCTTTCTAGTTTTTATGTGGG + Intergenic
1191581616 X:62768482-62768504 CTTCTTTCTAGTTTCTATCTGGG + Intergenic
1192946781 X:75971728-75971750 CCTCTAAACAGTTTCAAAGTGGG - Intergenic
1195909859 X:109878182-109878204 CTTTTAACCACATTCAATGTAGG - Intergenic
1197875229 X:131095887-131095909 CTTCCAACCTGTTTATACGTTGG + Intergenic
1198475394 X:136992074-136992096 CTTCTTACCACTTCCTATCTGGG + Intergenic