ID: 1091942543

View in Genome Browser
Species Human (GRCh38)
Location 12:4501261-4501283
Sequence AGGTGGACAAGTAGGGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 266}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091942543 Original CRISPR AGGTGGACAAGTAGGGAGTA AGG (reversed) Intronic
900103912 1:974175-974197 AGGGGGGCCAGTAGGGAGTTGGG + Intronic
900779596 1:4609119-4609141 AGCTGGACCAGGAGGGAGGATGG - Intergenic
901441766 1:9282440-9282462 AGGAGGAAAAGGAGGGAGCAGGG - Intergenic
901746119 1:11374853-11374875 GGGAGGACAAGGAGGGAGCAGGG + Intergenic
902144820 1:14389722-14389744 AGGTGGAGGGGTAGGGAGTGGGG + Intergenic
902162505 1:14542694-14542716 CTGTGGACTAGTAGAGAGTAGGG - Intergenic
902754535 1:18540365-18540387 GGGTGGACAAGTAGTGAAGATGG + Intergenic
904069854 1:27786183-27786205 AGGTGGCCAAGGAGGTAGTAGGG - Intronic
904418216 1:30375566-30375588 AGGTGGAGAAGTGGGGAGGCTGG - Intergenic
904418230 1:30375620-30375642 AGGTGGAGAAGTGGGGAGGCTGG - Intergenic
904418258 1:30375729-30375751 AGGTGGAGAAGTGGGGAGGCTGG - Intergenic
904418285 1:30375835-30375857 AGGTGGAGAAGTGGGGAGGCTGG - Intergenic
904418327 1:30375999-30376021 AGGTGGAGAAGTGGGGAGGCTGG - Intergenic
904418340 1:30376053-30376075 AGGTGGAGAAGTGGGGAGGCTGG - Intergenic
905849898 1:41265892-41265914 AGGAGGACAGGAAGGGAGCAAGG + Intergenic
905958110 1:42016305-42016327 AGGTGGACAGACAGGCAGTAAGG + Intronic
907553801 1:55327251-55327273 AGGTGGAGAAGGAGGGAAGAAGG + Intergenic
909326562 1:74358308-74358330 AGGTGGAGAATTAGTGAATAAGG + Intronic
910701694 1:90081968-90081990 AGAAGGACAAGAAGAGAGTAAGG - Intergenic
910754006 1:90666562-90666584 ACGTGAACAAGGAGGGAGTTAGG - Intergenic
910765357 1:90776835-90776857 TGGTGAACCTGTAGGGAGTAGGG + Intergenic
916272785 1:162961860-162961882 AGATGGGCAAGTAGGCAATAAGG - Intergenic
916313947 1:163427079-163427101 GGGAAGGCAAGTAGGGAGTAGGG - Intergenic
916422602 1:164650875-164650897 AGGAGGAAAAGAAGGGAGAAGGG - Intronic
917231070 1:172838761-172838783 AGGAGGAAAAGCAGGGAGCAGGG + Intergenic
920775340 1:208931262-208931284 AGGTGGTCAGACAGGGAGTAGGG + Intergenic
920779862 1:208978752-208978774 GGCTGGAGAAGTAGGGAGGAAGG + Intergenic
1064558800 10:16575029-16575051 CAATGGACAAGTAGGAAGTATGG + Intergenic
1064635242 10:17358596-17358618 AGGAGGAGAAGGAGGGAGGAAGG + Intronic
1066298219 10:34074755-34074777 AGCTGGACAAGTGGGGAGGAAGG + Intergenic
1067752893 10:48983626-48983648 AGGTGGACACATAGGGACTTGGG + Intergenic
1069417251 10:68211536-68211558 AGGTGGAAAAGTTGGGAGAAAGG + Exonic
1070718224 10:78738146-78738168 AGTTAGAAAAGTAAGGAGTAAGG + Intergenic
1072300100 10:94052348-94052370 AGAAGGAGAAGTAGGGAGGAGGG - Intronic
1072301675 10:94067885-94067907 AGGTGGAGAAGGGAGGAGTATGG + Intronic
1072615904 10:97048813-97048835 AGGTGGACAGGTAGGCAGGCAGG + Intronic
1072615920 10:97048877-97048899 AGGTGGACAAGTAGGCCGGTGGG + Intronic
1074606377 10:114972724-114972746 AGGTGGTGAAGAAGGGAGTGAGG - Intronic
1075291877 10:121238135-121238157 ATGGGGACAAGTGGGGAGGAAGG - Intergenic
1075350441 10:121719863-121719885 AGGTGCACATGTGGGGAGAAGGG + Intergenic
1079108472 11:17589504-17589526 AGGTGGACAAGTGAGGAGCTAGG - Intronic
1080313546 11:30922999-30923021 AGGTGGGAAAGAAGGGAGCAAGG + Intronic
1081589406 11:44410604-44410626 AGGTAGGCAAGGAGGGAGAAAGG + Intergenic
1081719707 11:45279340-45279362 AGGAGGACAAGTCAGGAGGATGG + Intronic
1082971802 11:59030558-59030580 AGGGGGAAGAGTAGGGAATACGG - Intronic
1083081292 11:60096260-60096282 AGATTGACAAGTAGGAAGTGGGG + Intronic
1083142314 11:60732269-60732291 TGGAGGAAAAGCAGGGAGTAAGG + Intronic
1083975829 11:66119101-66119123 CAGAGGACAAGCAGGGAGTAGGG - Intronic
1084208855 11:67611691-67611713 AGGTGGAAGAGGAGGGAGGAAGG + Intronic
1084214421 11:67639820-67639842 GGGAGGACAAGGAGGGAGGAAGG - Intergenic
1084957490 11:72699068-72699090 AGGTGTACACGGAGGGAGAACGG - Exonic
1085023378 11:73222680-73222702 AGGTGGGCAAAGAGGGAGGAGGG - Intronic
1085259527 11:75196318-75196340 AGGTGGGCAAGTATGGAGACAGG - Intronic
1086391918 11:86374398-86374420 AGCTGGAGAAGTGGGGAGGAGGG - Intergenic
1088329465 11:108635363-108635385 AGGTGGACAAGGAAGTAGGAGGG - Intergenic
1088601253 11:111478149-111478171 AGGAGGACAAGTAGAGAGTTAGG + Intronic
1089680037 11:120114235-120114257 GGGTGGAAAAGTATGTAGTAGGG + Intronic
1089851189 11:121498003-121498025 AGCAGGAAAAGCAGGGAGTAAGG + Intronic
1091828666 12:3534035-3534057 AGGTGGGCAAGGAGGGAAGAAGG + Intronic
1091942543 12:4501261-4501283 AGGTGGACAAGTAGGGAGTAAGG - Intronic
1092456445 12:8647936-8647958 GGGTGAAAAAGTAGAGAGTAGGG + Exonic
1092498229 12:9019658-9019680 AGGTGGGGAAGATGGGAGTACGG - Intergenic
1092786829 12:12033975-12033997 AGGTGGAAAAGAAGGTAGTCTGG + Intergenic
1092937915 12:13380848-13380870 AGGTGGAGATGGAGGGAGGATGG - Intronic
1093594934 12:20948683-20948705 AGGCAGACAAGTAAGGGGTAAGG - Intergenic
1095122167 12:38432586-38432608 AGGTGGACAAGAAGACAGTGGGG - Intergenic
1095678143 12:44943890-44943912 AGCTGGACAAGGAGGAAGTGAGG + Intergenic
1096006564 12:48178085-48178107 AGGTGGAAAAGTTGGGGGAAAGG + Intronic
1096977173 12:55706199-55706221 AGATGGAGAAGGAGGGAGGAAGG + Intronic
1096979301 12:55719229-55719251 GGGTGGTGAGGTAGGGAGTATGG - Intronic
1097967342 12:65595340-65595362 ATGGGGAGAAGTAGGGAGTGCGG - Intergenic
1103340832 12:120220368-120220390 AGGTGGACAAATGGGGAGCCAGG + Intronic
1103769114 12:123306611-123306633 AGGTGGACAAGGTGAGAGGATGG + Intronic
1104578850 12:129994214-129994236 AAGAAGACAAGTAGGTAGTATGG + Intergenic
1104781276 12:131422094-131422116 AGGTGGAGGAGGAGGGAGGAGGG - Intergenic
1106768279 13:32937861-32937883 AGCTGGAGAAGTTGGGAGTTAGG - Intergenic
1107295746 13:38905486-38905508 ATGTGGACACATAAGGAGTAAGG - Intergenic
1107405738 13:40111047-40111069 AGGTAGACAATAAGGGAGAAAGG + Intergenic
1107525958 13:41231438-41231460 GGGAGGGCAAGTATGGAGTATGG + Intronic
1107609402 13:42097764-42097786 AGGTGAAGAAATAGGGAGTGAGG + Intronic
1108327054 13:49344046-49344068 AGGTAGACAAATCAGGAGTATGG + Intronic
1108357589 13:49641647-49641669 GGGTGGACAAGTTTGGAGAATGG + Intergenic
1110703775 13:78580598-78580620 ATGTGGACATGAAGAGAGTATGG - Intergenic
1110822526 13:79933445-79933467 AGTTGGAAAAGCAGGCAGTAAGG - Intergenic
1113303874 13:109054961-109054983 AGGAGGAAAAGGAGGGAGGAAGG - Intronic
1116392334 14:44408069-44408091 GGTTGGAAAAGTAGGGGGTAGGG + Intergenic
1116513494 14:45777142-45777164 AGCTGGAGAAGTTGGGAGAATGG - Intergenic
1117898335 14:60509724-60509746 CTGTGGACAAGTACCGAGTAAGG + Exonic
1118419766 14:65589049-65589071 AAGTTGAAAAGGAGGGAGTAGGG - Intronic
1118722192 14:68602191-68602213 AGGTGGACAAGCAGGAAGGCAGG - Intronic
1119207156 14:72802965-72802987 AGGTGGAGAGGTAGGCAGTGGGG - Intronic
1119684837 14:76623352-76623374 ATGTGGAGAAGAAGGGAGGAGGG - Intergenic
1122199275 14:100112549-100112571 AGGAGGAGAGGTAGAGAGTAGGG - Intronic
1123574007 15:21647295-21647317 ATGTGGTCAGGTAGGTAGTATGG - Intergenic
1123610623 15:22089880-22089902 ATGTGGTCAGGTAGGTAGTATGG - Intergenic
1125513735 15:40306701-40306723 AGGTGGACAAGTCAGCACTAAGG + Intronic
1127920168 15:63488148-63488170 AGGTGGAAAGGGAGGGAGGAGGG - Intergenic
1128080115 15:64852081-64852103 AGATGGCCAAGCAGGGAGTCAGG + Intronic
1129620869 15:77144364-77144386 AGGTGGAGGAGTAGAGAGTAGGG - Intronic
1130243577 15:82221347-82221369 TGGAAGACAAGTAGGGAGAATGG - Intronic
1130723320 15:86411570-86411592 AGGTGGGCAATGAAGGAGTAAGG - Intronic
1130967192 15:88706029-88706051 AGGGGGACAAGAAGGGAGGCAGG - Intergenic
1131284725 15:91047842-91047864 AGGAGGAGGAGTAGGGAGGACGG - Intergenic
1131975041 15:97935791-97935813 AGGTGGACAAGGAATGAATATGG + Intergenic
1202982872 15_KI270727v1_random:381640-381662 ATGTGGTCAGGTAGGTAGTATGG - Intergenic
1132461545 16:57755-57777 CGGTGGACAGGGAGGGAGTGTGG + Intergenic
1135806468 16:25547296-25547318 AGGAGGGGAAGTAGGGAGGAAGG - Intergenic
1136425336 16:30166326-30166348 AGGTGGAAAAGTAGGAAATGAGG + Intergenic
1137905861 16:52321297-52321319 AGGTGGAGAAGCAGGGCTTAAGG + Intergenic
1139430106 16:66906531-66906553 AGATGGATAAGTAGGGAGATAGG - Intergenic
1141263675 16:82476238-82476260 AGGAGGAGAAGGAGGGAGGAGGG - Intergenic
1141329053 16:83091237-83091259 AGATGGAGAAAAAGGGAGTAGGG - Intronic
1141733705 16:85838935-85838957 GGGTGGATCAGTAGAGAGTAGGG + Intergenic
1143453382 17:7050328-7050350 AGGTGGACAGGGAGGGAGGCGGG + Intergenic
1148985280 17:51615518-51615540 AGGTAGACAAGTAGTCAGTGTGG - Intergenic
1149387521 17:56156629-56156651 AGGTGGAAAAGGAAGGAGTAAGG + Intronic
1150258326 17:63768035-63768057 GGGAGGAAAAGTAGGGAGTGGGG - Intronic
1150628619 17:66859879-66859901 AGGTGGAGAAGAAGGAAGAAGGG - Intronic
1150657558 17:67050164-67050186 AGATGGACCAGTAGGGAAAATGG - Intronic
1151433142 17:74078462-74078484 AGGTGGAGAAGAAGGGAGGGTGG + Intergenic
1151440957 17:74128801-74128823 AGGTGGATAAGGAGGCATTAAGG + Intergenic
1152613715 17:81328518-81328540 AGGTGGACAGGCAGGGGGTGGGG + Intronic
1152895099 17:82906324-82906346 AGGTGCACAAGGAGGCAGCAGGG - Intronic
1153328569 18:3848288-3848310 AGGAGGAGCAGTAGGGAGGAGGG + Intronic
1154085425 18:11300568-11300590 TGGAGGACAAGTGGGGATTATGG - Intergenic
1154515841 18:15164632-15164654 AGGAAGAAAAGTAGGGAGGAAGG - Intergenic
1158313930 18:56189710-56189732 AGGTGGAAAAGAAGCGAGAAAGG + Intergenic
1158558244 18:58492725-58492747 AGAGGGACAACTAGGGAATAGGG + Intronic
1159243566 18:65775758-65775780 AGTTGGACAAGTATGGTCTAAGG + Intronic
1159878527 18:73835613-73835635 AGGTGGGCAGGAAGGGTGTAAGG + Intergenic
1164587066 19:29482613-29482635 AGGGGGAAAAGAAGGGAGTTGGG - Intergenic
1164848192 19:31452380-31452402 AGGTGGACAGGGAGGGATGAGGG + Intergenic
1166329494 19:42069926-42069948 AGGTGGAGAGATAGGGAGGAGGG + Intronic
1166503509 19:43357337-43357359 AGGTGGACAAGGTGGGTGTGGGG + Intronic
1166506945 19:43377424-43377446 AGGTGGACAAGGTGGGTGTGGGG - Intergenic
1168020144 19:53603278-53603300 AGGGGGCCGAGTAGGGAGTGTGG - Intronic
925436900 2:3846250-3846272 AGGAGGAGAAGAAGGGAGTGGGG - Intronic
925940485 2:8812520-8812542 AGGTAGATAAGTAGGAAGGAAGG + Intronic
926982043 2:18583258-18583280 TGGGGGACAGGTAGAGAGTAGGG + Intronic
928702767 2:33915948-33915970 AGGGGGAGAAATAGGGATTACGG - Intergenic
929090963 2:38216967-38216989 TGGTGGCCAGGTAGGGTGTAAGG + Intergenic
929762448 2:44817221-44817243 AGATGGACAAATTGGGAGAATGG - Intergenic
934950326 2:98571388-98571410 AGGTGAGCAGGGAGGGAGTAGGG + Intronic
936021904 2:109001494-109001516 AGCTGGACAAGAAGGGAGAGGGG + Intergenic
936655101 2:114475791-114475813 AAGTAGACAAGTGGAGAGTAAGG + Intronic
940301320 2:152178709-152178731 AGGGGGAGAAATAGGGATTATGG - Intergenic
940651324 2:156443804-156443826 AGGTGGGTAAGTAGGGGGAAGGG - Intronic
941465196 2:165817266-165817288 AGGAGGACAAGGAGGAAGTTGGG + Intergenic
942568926 2:177293874-177293896 AGGGGGAGAAGGAGGGACTAAGG - Intronic
943465002 2:188218103-188218125 AGGAGGACAGGTAGGGGGTTGGG - Intergenic
948605855 2:239134341-239134363 AGGTGCTCAGGTAGGGAGTGAGG + Exonic
1169264343 20:4158484-4158506 AGGTGGAGAAGAAGGGAATCTGG - Intronic
1170142513 20:13139090-13139112 AGGAGGAGAAGGAGGGAGGATGG - Intronic
1172092554 20:32444503-32444525 AGGGGGACAGGCAGGGAGTTAGG - Exonic
1172303935 20:33868435-33868457 AGGTGGACAGGGAAGGAGCAGGG - Intergenic
1173488959 20:43463541-43463563 AGGTGAACAAATCGGGAGGAAGG - Exonic
1175735728 20:61385781-61385803 AGGTGGGCAGGAGGGGAGTACGG - Intronic
1177649204 21:23938931-23938953 AGGAGGAAAAGGAGGCAGTATGG - Intergenic
1180928064 22:19570105-19570127 AGGTGGAGTAGGATGGAGTAAGG + Intergenic
1183056425 22:35309312-35309334 AGATGGAAAAGTTGGGAGGATGG - Intronic
1183320181 22:37160468-37160490 AGGTGGACAGGTGGGGACCATGG + Intronic
1183469321 22:37997228-37997250 AAGTGGAAAAGAAGGGAGAAAGG - Intronic
949304473 3:2624460-2624482 AGGTTGACAAGTAGAAGGTAAGG - Intronic
952470923 3:33650763-33650785 AGGAGTACAAGAAGGGAGAAGGG + Intronic
952494995 3:33908082-33908104 TGGTGGAAAAGTGGGGAGAAGGG - Intergenic
952767284 3:36965260-36965282 GGGAGGACAAGGAGGGAGGATGG + Intergenic
952927493 3:38331395-38331417 GGGTGGAGAAGTGGAGAGTAAGG + Intergenic
953268525 3:41416798-41416820 AGGAGGAAAAGGAGGGAGAAAGG + Intronic
956888327 3:73583536-73583558 AGATGGACACATAGGGAGAATGG - Intronic
958051219 3:88349279-88349301 AGGAGGGCAAGTTGGGAGTGGGG - Intergenic
961435497 3:126913690-126913712 ATGTGGACATGTAGGCAGCAGGG - Intronic
961951009 3:130749076-130749098 AGATGGAGAAGAAGGGAGGAGGG - Intergenic
962727567 3:138247431-138247453 AGGGGGAGAAGTAGGGATTGAGG - Intronic
962769691 3:138600905-138600927 AGGAGGAGAAGGAGGGAGGAGGG + Intergenic
962769701 3:138600930-138600952 AGGAGGAGAAGGAGGGAGGAGGG + Intergenic
964011847 3:151901093-151901115 GGGTGGAGAAGTAGAGAGTAAGG - Intergenic
965840658 3:172901977-172901999 AGAAGAACAAGTAGGGAGTCTGG - Intronic
967986719 3:195100673-195100695 TGGTGGACGAGGAGGGAGAAGGG - Intronic
968038259 3:195567051-195567073 AGGTGGGCATGGAGGGAGGAGGG - Intergenic
969607837 4:8211302-8211324 AGGGGGAGAAGGAGGGAGGAGGG - Intronic
973156139 4:46955238-46955260 TGGTGATCAAGGAGGGAGTAAGG - Intronic
974865986 4:67581176-67581198 AGGTGAATGAGTAGGGACTAAGG - Intronic
976268438 4:83206801-83206823 AGGTGGACAAGGAGGAGGTCAGG - Intergenic
977323419 4:95547808-95547830 AGGCGGACAAGAAGGGAGCCGGG + Intronic
978621405 4:110637361-110637383 AGGAGGACCAGAAGGGAGGATGG + Intronic
979994356 4:127412550-127412572 AGGTGGGGAAGGAGGGAGGAGGG + Intergenic
980501390 4:133658815-133658837 AGGTGGAAGAGTAGGGATTTGGG + Intergenic
980872754 4:138628507-138628529 AATTGGATAAGTAGGGAGTGAGG + Intergenic
981041940 4:140231315-140231337 ACGTGGACAAAGAGTGAGTATGG - Intergenic
981950482 4:150400612-150400634 GGGAGGACAAGGAGGGAGGATGG + Intronic
984975693 4:185228268-185228290 AGATGGAAAAGTAGAGAGGAAGG + Intronic
985750357 5:1670062-1670084 AGGTAGACAAGTGGGGTTTAGGG - Intergenic
986343227 5:6810763-6810785 AGCTGGACATGGAGGTAGTAAGG + Intergenic
986708743 5:10472119-10472141 AGGAGGAGAAGTTGGGAGGAAGG + Intergenic
989225646 5:39025130-39025152 AGGAGGAGAAGGAGGGAGAAAGG - Intronic
989387833 5:40870941-40870963 AGAGGGACAGGTAGGCAGTAAGG + Intergenic
992071486 5:73153051-73153073 ATGTGGACACGTAAGGAGTGAGG + Intergenic
992769512 5:80034622-80034644 AGGTGGGCAAGCAGGGCGTTTGG + Intronic
993002112 5:82391685-82391707 AGGAGGACAAGTGGGAGGTATGG + Intergenic
995210331 5:109530535-109530557 AGGTGCACAAGTATGGAGGTTGG - Intergenic
996310918 5:122103954-122103976 AGTTGGAGGAGTAGGAAGTATGG - Intergenic
996711440 5:126547307-126547329 AGGTGGGCAGGGAGGGAGTAGGG + Intronic
997404492 5:133634143-133634165 AGATGGCCAAATAGGGAGTTTGG - Intergenic
997658069 5:135569891-135569913 AGGTGGACAGGTGGACAGTAGGG - Intergenic
1001735119 5:173991013-173991035 AGGAGGGCAAATAGGGAGAATGG - Intronic
1005579991 6:27224734-27224756 AGGTGGAGAATGAGGGAGTAGGG - Intergenic
1007266583 6:40600874-40600896 ATGTGGACAAGTGGGGAGCTAGG - Intergenic
1008348072 6:50454052-50454074 AGGTAGGCAAGTAGGGAAGAGGG + Intergenic
1009296746 6:61960196-61960218 AGGTGGAGAAGCAGGTTGTATGG - Intronic
1009938899 6:70267052-70267074 AGTTGGAGAAATAGGGAATAGGG - Intronic
1011019392 6:82794735-82794757 AGTTGGGCAAGTCGGGAGAAGGG + Intergenic
1013115023 6:107096697-107096719 AGCTGGAAAAGTAGGGAATGAGG + Intronic
1016060403 6:139623869-139623891 AGGTGGCCAAAAAAGGAGTAAGG + Intergenic
1018374882 6:163201551-163201573 AGGTGGATGAGTAGGGGTTAGGG - Intronic
1019117152 6:169774425-169774447 AGGTGGGCAGGTAGGGAGGAGGG + Intronic
1019266765 7:121526-121548 AGGTGGAGAGGAAGGGAGGAGGG + Intergenic
1021472737 7:21024326-21024348 AGGTGGGGAAGGAGGGAATAGGG - Intergenic
1021852529 7:24822468-24822490 GGGTGGAGAAGTGGGGAGTGGGG - Intronic
1022266889 7:28765572-28765594 AGGTAGACAGGAAGGGAGAAAGG + Intronic
1022483695 7:30761112-30761134 AGGTAGATAGGTAGGAAGTAGGG - Intronic
1024350850 7:48361338-48361360 AGGAGGATGAGTAGGGAGAAAGG - Intronic
1024519462 7:50292060-50292082 AGGTGGATAAGTTGGGAACATGG - Intergenic
1027389643 7:77692172-77692194 AGGTGGAGAAGCAGGGTGTAGGG + Intergenic
1027857246 7:83527396-83527418 AGGTGGACAAATAAGGAGAAAGG + Intronic
1028385775 7:90251322-90251344 AGGTGGACTAGCTGGAAGTAGGG + Intronic
1028397196 7:90383766-90383788 ATGAGGAAAAGTAGGGTGTATGG + Intronic
1028951888 7:96645480-96645502 AGGTAGACAAGTTGGGTGTTGGG + Intronic
1029139545 7:98400569-98400591 AGGAGGAAAAGTAGGGGGGAGGG + Intronic
1029160551 7:98548683-98548705 AGGTGCACAAGTAGGTAGGTAGG - Intergenic
1029594505 7:101530073-101530095 AGGTGGACAGATGGGGAGCAGGG + Intronic
1029793239 7:102867402-102867424 AGGTGGACAAGTAGTGGAGAAGG + Intronic
1030654149 7:112147901-112147923 AGATGGGGAAGTAGGGAGTTGGG - Intronic
1031687944 7:124755354-124755376 AGGTGGAGAATGAGGCAGTAAGG - Intronic
1032190694 7:129763954-129763976 GGGTGGGCAAGGAGGGAGGATGG - Intergenic
1035351173 7:158247341-158247363 AGGTGGGGAAGTGGGGAGGAGGG + Intronic
1036690035 8:10939504-10939526 AGGTGCCCAAGTAGGCAGTGAGG - Intronic
1037691275 8:21183419-21183441 AGGAGGAGAAGAAGGGAATAAGG - Intergenic
1038437167 8:27544235-27544257 AGATGGACAAGTAAGGAGGTTGG + Exonic
1038516661 8:28193396-28193418 AGGTGGACAAGAGGGGAATTAGG - Intergenic
1041019286 8:53622164-53622186 AGGGGGAGAAATAGGGACTATGG + Intergenic
1042446745 8:68893654-68893676 AGGGGGAGAAATAGGGACTATGG + Intergenic
1042572347 8:70179415-70179437 AGGAGGAAAAGAAGGGAGGAAGG + Intronic
1043449110 8:80349054-80349076 AGGTGGGCAAGGAGGGAGTGGGG + Intergenic
1047529599 8:125663166-125663188 AGTGGGACAAGTAGGGATTCTGG - Intergenic
1048245122 8:132787395-132787417 TTGTGGACAAGTAGGAAGCAGGG + Intronic
1048427542 8:134336790-134336812 AGGTGGCCTATTTGGGAGTAGGG - Intergenic
1048782597 8:138018013-138018035 TGCTGGACAAGTAGGGATCATGG - Intergenic
1049943728 9:574380-574402 AGGTGGAAAAGCAGGAAGTGAGG - Intronic
1049943737 9:574437-574459 AGGTGGAAAAGCAGGAAGTGAGG - Intronic
1050126504 9:2361710-2361732 AAGTAGTCAAGTAGGCAGTAAGG - Intergenic
1053524205 9:38812192-38812214 GGCTGGAAAAGTAGGGAGAATGG + Intergenic
1054196438 9:62036602-62036624 GGCTGGAAAAGTAGGGAGAATGG + Intergenic
1054641968 9:67552085-67552107 GGCTGGAAAAGTAGGGAGAATGG - Intergenic
1055720977 9:79174580-79174602 AGATGGACAAGTAGAGTGCAGGG + Intergenic
1056134746 9:83621156-83621178 AGGTGGAGAGCTAGGGAGTCCGG - Intergenic
1056618045 9:88185371-88185393 AGGTGGAAGAATAGGGAGTTGGG - Intergenic
1057298745 9:93864367-93864389 AGGTGGAGGAGTGGGGAGAAGGG - Intergenic
1057558747 9:96110786-96110808 AGGTGGAAAAGGAAGGGGTAGGG - Intronic
1058751513 9:108042894-108042916 AGGGGGAAAAGCTGGGAGTATGG - Intergenic
1059332318 9:113543335-113543357 AGGAGGATAAGTGGGAAGTAAGG - Intronic
1060486900 9:124053499-124053521 AGGTGGAAAAGTACCCAGTATGG - Intergenic
1060772996 9:126346372-126346394 AGGTGGGGGAGTAGGGAGGAAGG + Intronic
1061999145 9:134207358-134207380 AGGAGGACAGGTGGGGAGGACGG - Intergenic
1061999206 9:134207534-134207556 AGGAGGACAGGTGGGGAGGACGG - Intergenic
1061999268 9:134207710-134207732 AGGAGGACAGGTGGGGAGGACGG - Intergenic
1062730551 9:138105879-138105901 AGGAGGACACGCAGGGAGGAGGG + Intronic
1185915403 X:4028990-4029012 AGGTGGAGAAGTGGGAAGGAAGG + Intergenic
1188916934 X:35922935-35922957 AGGTGGAGAAGAAGCGAGGAAGG - Intronic
1188952999 X:36399767-36399789 AGAAGCACAAGTAGGGAGCAGGG - Intergenic
1189192687 X:39124000-39124022 AGGTGGAGAATAAAGGAGTATGG - Intergenic
1192687137 X:73318819-73318841 AGGGGGACATGTTGGGAGCAGGG - Intergenic
1193219808 X:78910922-78910944 AGGAGGAAAAGAAGGGAGTTAGG - Intergenic
1195385884 X:104313290-104313312 AGGGGGACAAAGAGGGAGGAAGG - Intergenic
1195460926 X:105123233-105123255 AGAAGGAAAAATAGGGAGTAGGG + Intronic
1197041401 X:121940103-121940125 GGGTGTACGAATAGGGAGTAGGG - Intergenic
1197252243 X:124228288-124228310 AGGAGGACAAGTAGGAAGCAGGG + Intronic
1197886043 X:131219536-131219558 GGGTGGTCAGGAAGGGAGTAGGG + Intergenic
1198303216 X:135351356-135351378 TGATGGAGAAGAAGGGAGTAAGG + Intronic
1200280184 X:154770668-154770690 AGGAGGACAACAAGGGAGTGGGG - Intronic
1201113628 Y:10819158-10819180 AGGTGGAACGGTATGGAGTATGG - Intergenic
1201550103 Y:15210363-15210385 AGGAGGACAGGAAGGGAGAAAGG + Intergenic