ID: 1091944291

View in Genome Browser
Species Human (GRCh38)
Location 12:4521449-4521471
Sequence CAACAGAAACAGATTTAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 534
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 489}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091944286_1091944291 24 Left 1091944286 12:4521402-4521424 CCAGAAAAGCAAGAAAAAAACCC 0: 1
1: 2
2: 0
3: 94
4: 985
Right 1091944291 12:4521449-4521471 CAACAGAAACAGATTTAGAAAGG 0: 1
1: 0
2: 1
3: 43
4: 489
1091944288_1091944291 3 Left 1091944288 12:4521423-4521445 CCAACCCACTGTCGAGATAAAGC 0: 1
1: 0
2: 0
3: 0
4: 71
Right 1091944291 12:4521449-4521471 CAACAGAAACAGATTTAGAAAGG 0: 1
1: 0
2: 1
3: 43
4: 489
1091944287_1091944291 4 Left 1091944287 12:4521422-4521444 CCCAACCCACTGTCGAGATAAAG 0: 1
1: 0
2: 0
3: 9
4: 86
Right 1091944291 12:4521449-4521471 CAACAGAAACAGATTTAGAAAGG 0: 1
1: 0
2: 1
3: 43
4: 489
1091944289_1091944291 -1 Left 1091944289 12:4521427-4521449 CCCACTGTCGAGATAAAGCAATC 0: 1
1: 0
2: 0
3: 6
4: 114
Right 1091944291 12:4521449-4521471 CAACAGAAACAGATTTAGAAAGG 0: 1
1: 0
2: 1
3: 43
4: 489
1091944290_1091944291 -2 Left 1091944290 12:4521428-4521450 CCACTGTCGAGATAAAGCAATCA 0: 1
1: 0
2: 1
3: 4
4: 87
Right 1091944291 12:4521449-4521471 CAACAGAAACAGATTTAGAAAGG 0: 1
1: 0
2: 1
3: 43
4: 489

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091944291 Original CRISPR CAACAGAAACAGATTTAGAA AGG Intronic
901156449 1:7142856-7142878 CAACACAAACAGACTAAGACAGG + Intronic
902525212 1:17053060-17053082 GAAGAGGAACAGACTTAGAAAGG + Intronic
902973665 1:20073219-20073241 CAACAGAAACAAAGACAGAAAGG + Intronic
904656001 1:32047677-32047699 AAACAGAAACAAAGGTAGAAAGG - Intronic
905119856 1:35673241-35673263 GTAAAGAAAGAGATTTAGAAGGG - Intergenic
906161866 1:43655945-43655967 GAACAGGAACAGGTTTAGACTGG - Intronic
906192688 1:43908197-43908219 CAAGCCAGACAGATTTAGAAGGG - Intronic
906865598 1:49415566-49415588 CAACAGAAATAAAACTAGAAAGG + Intronic
906989694 1:50724667-50724689 TAAGAGAAACAAATCTAGAATGG - Intronic
908460709 1:64346144-64346166 CAACAACAACAAATTTAAAAAGG - Intergenic
908587751 1:65591144-65591166 TAACAGAAAGATATTTGGAAAGG - Intronic
908993751 1:70127170-70127192 AAGCAGAAACAGTTTTATAAAGG - Intronic
909142631 1:71888174-71888196 AAAAAGAAACTGATTTAGAATGG + Intronic
909298864 1:73985292-73985314 CCACATAAACAGAATTAAAAAGG - Intergenic
909308438 1:74112958-74112980 CAACAGAAACCAACATAGAAAGG + Intronic
910270072 1:85385276-85385298 AATCAAAAACAGATTCAGAATGG + Intronic
910564789 1:88631290-88631312 CAACAGGAACAGATTCAGGTGGG + Intergenic
911629270 1:100164329-100164351 CAAAAGAAGCAGATTTGAAAGGG - Intronic
912078399 1:105907431-105907453 TAACAGAAAAATATTTAGAAGGG + Intergenic
912484500 1:110014650-110014672 CAAAAGAAACAATTTCAGAAGGG - Intronic
912769345 1:112448780-112448802 CTAAAGAAACAGCATTAGAAAGG - Intronic
914419715 1:147518229-147518251 CACCAGATACAGATTATGAAGGG - Intergenic
915633405 1:157169661-157169683 CATCACAAACATCTTTAGAAGGG + Intergenic
915636679 1:157192230-157192252 CATCACAAACATCTTTAGAAGGG + Intergenic
916756819 1:167778624-167778646 AATCAGAAACAAATTCAGAATGG + Intronic
917013349 1:170500696-170500718 ATACAGAAACAGGTTCAGAAAGG - Intergenic
917627765 1:176863222-176863244 CAACACAAGCAAATTTAGCAAGG + Exonic
917662588 1:177191763-177191785 CAAATGAACCAGATTTAGAAAGG - Intronic
917779370 1:178375782-178375804 TAACAGAAATAAATTGAGAAAGG + Intronic
917980894 1:180268356-180268378 CAAGAGAAACAGATGTAGATTGG + Intronic
918641210 1:186843132-186843154 TAAAAAAAACAGATTTGGAAAGG - Intronic
918820954 1:189253696-189253718 CAACAGAAACCGCGGTAGAAAGG + Intergenic
919023623 1:192140086-192140108 TCACAGAAATAGATTGAGAATGG - Intergenic
919028952 1:192214315-192214337 GAAAAGAAAAAGACTTAGAATGG + Intergenic
919123344 1:193367866-193367888 CAAGAGAACCAGAATTAGAAGGG - Intergenic
920546853 1:206825557-206825579 CAACATAACTAGATTCAGAAGGG - Intronic
920628911 1:207632437-207632459 GAACACAAACACATTTATAAGGG + Intronic
920875028 1:209826994-209827016 CAGCAGAAACACATCTAGAGAGG - Intergenic
920909282 1:210199602-210199624 CAACAGATAAACATTTAAAATGG + Intergenic
921811320 1:219517793-219517815 AAACAAAAAAAGATTTAGAAAGG - Intergenic
921968012 1:221113937-221113959 TAATAGAAACAGATCAAGAAAGG - Intergenic
922386502 1:225089493-225089515 AAAAGAAAACAGATTTAGAAAGG + Intronic
923213144 1:231824474-231824496 AAACACAAACAGATTTAGTCAGG - Intronic
923367867 1:233280827-233280849 CAGAAGAAACAGATTTACAAAGG - Intronic
924259820 1:242217772-242217794 CAAGAGAACTAGAATTAGAAGGG + Intronic
1063086820 10:2827159-2827181 AAACAGAAACACACTTAAAACGG - Intergenic
1065190124 10:23200269-23200291 CAACAGGAAAAGAGCTAGAAGGG - Intergenic
1065259195 10:23907376-23907398 CAAGAGAGAGAGATTTAGCATGG + Intronic
1065648221 10:27859318-27859340 CCATAAAAACAGATTTATAATGG + Intronic
1065785075 10:29205209-29205231 TGATAGAAAAAGATTTAGAATGG + Intergenic
1066323255 10:34327112-34327134 CAATAGAAACTGATTTATCATGG + Intronic
1066366313 10:34780108-34780130 CAAAAGAAGCAGAGTTAAAATGG - Intronic
1067018901 10:42778331-42778353 CAACAGAAGTAGATACAGAAAGG - Intergenic
1068013364 10:51482612-51482634 AAACAGAAACCTCTTTAGAAAGG - Intronic
1068075213 10:52245212-52245234 CTACAGAAACAGTTTGAAAAAGG - Intronic
1068304076 10:55180811-55180833 CAAAACAAACACTTTTAGAAAGG - Intronic
1068547722 10:58368885-58368907 CTTCAGAAACACATTTAAAATGG - Exonic
1068674955 10:59761190-59761212 TCATAGAAACAGATGTAGAAAGG - Intergenic
1068766772 10:60773225-60773247 CAGCAGGAACAAACTTAGAAAGG - Intergenic
1069105642 10:64380379-64380401 CAACTGAAACAGAGTAACAAAGG - Intergenic
1069138408 10:64794216-64794238 CAACACAAACAGACTAAGACAGG + Intergenic
1069157931 10:65053427-65053449 AAACAGAGACAGAGTAAGAAAGG + Intergenic
1069183493 10:65392911-65392933 TAAATGAAACAGATTTGGAAAGG - Intergenic
1070379567 10:75868581-75868603 AAACAGAATCAGAATTTGAATGG + Intronic
1071316383 10:84403960-84403982 CAAAAGTTACAGATTTAGAGAGG + Intronic
1071438984 10:85673138-85673160 CAAGAGAACTAGAATTAGAAAGG + Intronic
1072197794 10:93131525-93131547 ACAAAGAAACAGATTCAGAATGG - Intergenic
1073817781 10:107226138-107226160 AAATAGAAACTGACTTAGAAAGG - Intergenic
1073856115 10:107675147-107675169 TATCAGAAACAGAATTAAAATGG + Intergenic
1074070809 10:110067280-110067302 CTACAGAAATAATTTTAGAAAGG - Intronic
1075302519 10:121338132-121338154 TTTCAGAATCAGATTTAGAAGGG + Intergenic
1075867548 10:125739097-125739119 CAATTGAAACTGATTTAAAAGGG - Intronic
1076308870 10:129487631-129487653 CAACAGAAACACAGGCAGAAAGG - Intronic
1077399224 11:2345311-2345333 CAACATAAACAGACTAAGACAGG - Intergenic
1077628677 11:3796386-3796408 CAAAAAATTCAGATTTAGAAAGG + Intronic
1078737230 11:14031475-14031497 TAACAGAAACATAATTTGAATGG - Intronic
1079670939 11:23170199-23170221 CAAGAGAAAGAGAGGTAGAAGGG - Intergenic
1079778540 11:24566118-24566140 CAACAGAAACTGTTTTTCAAGGG + Intronic
1080956023 11:37096721-37096743 CAACAAAGACATATTCAGAAAGG - Intergenic
1081287573 11:41289806-41289828 CAACAGAATTAGATTCAGAAAGG + Intronic
1081301437 11:41457362-41457384 CAAAAGAAACAGGTTAATAAAGG + Intronic
1081515943 11:43829738-43829760 CACCAGAAACAGAATAAGGAAGG - Intronic
1082892016 11:58149647-58149669 CCATAGAAACAGAACTAGAATGG - Intronic
1083450510 11:62741458-62741480 AAACAGAAACAGAATAACAAAGG - Intergenic
1084634671 11:70383589-70383611 CAGCATGAACAGATTTAAAATGG + Exonic
1084875348 11:72128141-72128163 AGACAAAAACAGATTTTGAAAGG + Intronic
1087185003 11:95180855-95180877 CAACAGAAACACTTTTAAAATGG + Intronic
1087189931 11:95243015-95243037 AGACAGAGAGAGATTTAGAAAGG - Intergenic
1087305430 11:96484229-96484251 AAACAAATACAGATTTAGTATGG - Intronic
1087330908 11:96778647-96778669 CATCAGAACCAGATATAGATAGG + Intergenic
1087948142 11:104190113-104190135 ACACAGAAACAGGCTTAGAATGG - Intergenic
1088829736 11:113525118-113525140 TAAAAGAAAGTGATTTAGAAAGG + Intergenic
1088997999 11:115020260-115020282 TAATAGAAACAGAATTGGAAGGG + Intergenic
1090485791 11:127110855-127110877 CAGCAGACACAGATATAAAAGGG - Intergenic
1090675211 11:128986053-128986075 CAGCAGCAACAGATGAAGAAAGG - Exonic
1090827618 11:130398847-130398869 TAACAGAAACAGAAGGAGAAAGG + Intergenic
1091944291 12:4521449-4521471 CAACAGAAACAGATTTAGAAAGG + Intronic
1091961718 12:4701183-4701205 GAAAAGAAGCAGATTTACAAGGG + Intronic
1092569618 12:9708320-9708342 TATCAGAAACAGTGTTAGAATGG - Intergenic
1092729573 12:11516597-11516619 TAACAGATACAGGTGTAGAAAGG - Intergenic
1093883990 12:24438708-24438730 CAAGAGAACTAGAATTAGAAGGG + Intergenic
1095535865 12:43246572-43246594 CACCAGAAACAGACATATAAGGG - Intergenic
1096241063 12:49960842-49960864 TGACAGAAACAGATTTCGAGGGG + Intergenic
1096587090 12:52629842-52629864 CAAGGGGAACAGATTGAGAAGGG - Intergenic
1096756868 12:53806881-53806903 CAACAGAAACCCATTTGTAATGG + Intergenic
1097306091 12:58070778-58070800 CAAAAGACAGTGATTTAGAATGG - Intergenic
1097772359 12:63603016-63603038 AAACAAAAACAGATTCAGAAAGG + Intronic
1098171039 12:67747507-67747529 GAACAGGAACAGATTGGGAAAGG + Intergenic
1098312071 12:69158225-69158247 CAACAGAAACAAAGACAGAAAGG - Intergenic
1098913364 12:76232876-76232898 CAATAGAAACATATTTATTATGG - Intergenic
1099564416 12:84223617-84223639 CAACACAAAAAGATCTAGAAAGG - Intergenic
1099711581 12:86232608-86232630 AAACATGAACAGATTGAGAAGGG + Intronic
1099852218 12:88115132-88115154 AAAAAGAAAGAGATTTAGAAAGG - Exonic
1099889047 12:88567038-88567060 GAACAGAATTAGATTTAAAAAGG - Intronic
1100274077 12:93055493-93055515 CAACTGAATCAGAATTTGAATGG + Intergenic
1100338689 12:93657206-93657228 CAATAGAAAGAGATTTGGTAAGG - Intergenic
1100341665 12:93685056-93685078 GAACTGAAACAGAAATAGAAAGG - Intronic
1102862882 12:116351711-116351733 AAACAAAAACAGGTTTAGAAGGG + Intergenic
1103135533 12:118503918-118503940 CAACAAAACCAGTTTTAAAAGGG - Intergenic
1103501871 12:121409350-121409372 CAACAGAAAAACATGTAGACAGG + Intronic
1104168299 12:126255265-126255287 CAACAGAAAAAGAGTGAGATGGG + Intergenic
1105661493 13:22500458-22500480 CAACAGAAACACATTTTCGAAGG - Intergenic
1106826816 13:33531666-33531688 CAACAGACATAGAGATAGAAAGG + Intergenic
1106875945 13:34072932-34072954 CCACATAAACAGAATTAGCATGG - Intergenic
1106954017 13:34915670-34915692 GAACAGAAAGAGATATAGAATGG + Intergenic
1107157309 13:37184141-37184163 GAACTTAAACAGATTTACAAAGG + Intergenic
1107359075 13:39600703-39600725 TAAGAGAAATAGATTTGGAATGG - Intronic
1107485987 13:40827995-40828017 CATCAGAAACAAAAGTAGAATGG + Intergenic
1107583325 13:41816036-41816058 GAATAGGAACAGATTTAAAATGG + Intronic
1109098940 13:58154417-58154439 TAAAAGCAACAGTTTTAGAAAGG + Intergenic
1109334642 13:60978869-60978891 GAAAATAAACATATTTAGAAAGG + Intergenic
1110044691 13:70813278-70813300 AAACTGAAACATATTTAAAAGGG + Intergenic
1110534884 13:76639496-76639518 GAGCAGTAACAGTTTTAGAAAGG - Intergenic
1110553662 13:76834640-76834662 AAAAAGAAAAAGATTTAAAAAGG + Intergenic
1110870853 13:80451230-80451252 CAACAGAAAAAAATTGAGAAAGG - Intergenic
1111156862 13:84338912-84338934 GAAGAGAAAAATATTTAGAAAGG + Intergenic
1112119065 13:96389806-96389828 TAACAGAAACAGAATCAAAATGG + Intronic
1112254360 13:97816013-97816035 CATCAGGAACACATTTAGAATGG - Intergenic
1112481919 13:99783981-99784003 CAACAAAAAATGATTTAGATAGG - Intronic
1113224158 13:108141001-108141023 AAACAGACACACATTTAAAAGGG + Intergenic
1114083879 14:19223523-19223545 CTACAGAGACAGAATTAAAAGGG + Intergenic
1114261452 14:21039529-21039551 CAACAGAAAAAGATGGAGGAAGG - Intronic
1114914459 14:27245421-27245443 AATCACAGACAGATTTAGAAGGG + Intergenic
1115605376 14:34995833-34995855 AATCAGAAACAGGTTTAAAATGG + Intronic
1115627787 14:35212157-35212179 CAAGAGAACTAGAATTAGAAGGG - Intronic
1116029938 14:39559349-39559371 CAACAGAAACTGTCTTTGAAGGG - Intergenic
1116124695 14:40768575-40768597 GAACAGAAAAATAGTTAGAAAGG - Intergenic
1116294978 14:43096157-43096179 CAATAGAAACATATTTAAAAAGG + Intergenic
1117249162 14:53918206-53918228 CAGCACAAACAGATTAAGACAGG - Intergenic
1117661570 14:58011360-58011382 CAACAGAAATATATTGAGACTGG + Intronic
1117931158 14:60841607-60841629 CAATAGAAGCAGACTCAGAAAGG - Intronic
1118235878 14:64004638-64004660 AAAGTGAGACAGATTTAGAAAGG - Intronic
1118403795 14:65403877-65403899 AAAAAGAAACAAATCTAGAAAGG - Intergenic
1118433178 14:65742879-65742901 CAACAGATTCAGAATGAGAATGG + Exonic
1118462585 14:66000407-66000429 CAAGAGAAACAGACTTGAAAAGG + Intronic
1118668423 14:68095992-68096014 AAAAAGAAACAGACTCAGAAAGG + Intronic
1119735439 14:76978479-76978501 CAACAGAAATAGATTTCTCATGG + Intergenic
1120402803 14:84053601-84053623 CAACAAAAATATTTTTAGAATGG + Intergenic
1121118611 14:91361243-91361265 TAACAGAAACACATTTTTAAAGG - Intronic
1121331025 14:93049900-93049922 CAGCACAAGCAGATTTGGAAGGG + Intronic
1121705005 14:95985525-95985547 CAAGAGAACTAGAATTAGAAGGG - Intergenic
1121749081 14:96331611-96331633 CCACTGAAACAGATCTAGATGGG + Exonic
1123872380 15:24589989-24590011 AAACTGAAACACATTTAAAAGGG + Intergenic
1124883782 15:33665274-33665296 CTAAAGAAACAGATACAGAAAGG - Intronic
1125239306 15:37555305-37555327 AAAAAGAAACAAATCTAGAATGG + Intergenic
1125628680 15:41130102-41130124 CAACTAAAATAGATTTAGGATGG + Intergenic
1125828994 15:42699273-42699295 CAACAGGTACAAAGTTAGAAAGG - Intronic
1126490821 15:49233543-49233565 AAACAGAAAGAGATTTTGAGAGG - Intronic
1126631395 15:50739899-50739921 CTTCAGAAACAGATTTAAATTGG - Intronic
1126640438 15:50819432-50819454 TAACAGGAACAGATTTATTAAGG + Intergenic
1126832563 15:52623158-52623180 CAAAAAAAAAAGGTTTAGAAAGG + Intronic
1127385766 15:58465447-58465469 CAACAGAAAAAAATTTAAATGGG + Intronic
1127727666 15:61766199-61766221 TAACAAAAATATATTTAGAAAGG + Intergenic
1127989440 15:64101299-64101321 TGACAGAAACAAAGTTAGAATGG - Intronic
1129794746 15:78367577-78367599 AAACAAAAACAGAATTACAAAGG + Intergenic
1130840372 15:87694274-87694296 CAACACAAACAGATGAAGAGTGG + Intergenic
1131472516 15:92709232-92709254 CAACAGAAACAGTCTTGGAGAGG - Intronic
1131837235 15:96402999-96403021 ACACATAAACAGCTTTAGAATGG + Intergenic
1132269728 15:100513119-100513141 CAAGAGAAACACATCTTGAAGGG - Intronic
1133684811 16:8156237-8156259 CAAGAGAACTAGAATTAGAAGGG + Intergenic
1135265147 16:21018964-21018986 CAACACACACAGAAATAGAAAGG + Intronic
1135676798 16:24422217-24422239 TCACTAAAACAGATTTAGAAAGG - Intergenic
1137577266 16:49608532-49608554 AAACAGAAGAAGATTCAGAAAGG + Intronic
1138233148 16:55354806-55354828 TAACATACACAGAATTAGAAAGG + Intergenic
1139269601 16:65670023-65670045 CCACACAAACAGATTAAGACAGG - Intergenic
1139316368 16:66073050-66073072 CAATAGATACAGACTCAGAAGGG + Intergenic
1139440110 16:66962363-66962385 CAACACAAACAGACTAAGACTGG - Intronic
1140189862 16:72806164-72806186 ATACAGAAGCAGTTTTAGAAAGG - Intronic
1144186931 17:12805448-12805470 CAACAGACACATATTTAGCATGG - Intronic
1144496726 17:15750240-15750262 AAACAGAGACAGAGTAAGAAAGG - Intergenic
1144606291 17:16667631-16667653 AAACAGAGACAGAGTAAGAAAGG - Intergenic
1144904915 17:18634647-18634669 AAACAGAGACAGAGTAAGAAAGG + Intergenic
1145356414 17:22159098-22159120 CAAGAGAAACAGAATTCAAATGG - Intergenic
1146788743 17:35739616-35739638 AAACAGAAAAAGATTCAGACTGG - Intronic
1147041262 17:37721197-37721219 CACAATAAACAGATTTATAATGG - Intronic
1149205856 17:54247199-54247221 AAACAGGAACTGATTTACAATGG + Intergenic
1149226256 17:54474585-54474607 CAAAAGACACAGTTTAAGAAAGG - Intergenic
1149745602 17:59094728-59094750 GAAAAGAAACAGATTTGGCATGG + Intronic
1149930609 17:60751061-60751083 CTACAGAAATACCTTTAGAAAGG - Intronic
1150965038 17:69958542-69958564 CAACGGAAACAGTTGTATAAGGG + Intergenic
1151064307 17:71132490-71132512 CAATAGATAGAGATTTAAAATGG + Intergenic
1151277109 17:73043448-73043470 CTACAGAAACAGATTTGCCAGGG + Intronic
1152396104 17:80034778-80034800 AATCAGTAACAGATTTGGAATGG + Intronic
1153035506 18:758529-758551 GAACAGAGACAATTTTAGAAGGG - Intronic
1153560271 18:6365207-6365229 CCACACAAAAAGCTTTAGAAAGG + Intronic
1155617158 18:27735518-27735540 CAACAGAAACATATTAATCATGG - Intergenic
1155702498 18:28764832-28764854 AAACAGAAAATGATATAGAAGGG + Intergenic
1156047605 18:32894897-32894919 CAATAAAAACATGTTTAGAATGG + Intergenic
1156554798 18:38054996-38055018 AAAGAGAAACAGAATTAGGAAGG - Intergenic
1157227670 18:45881827-45881849 CAAGAGTAAAAGACTTAGAAAGG + Intronic
1157374957 18:47153948-47153970 CAGCAGAACCAGATTTTCAAAGG - Intronic
1157540295 18:48497039-48497061 CAACAGAACCATATTCAGAGAGG + Intergenic
1157980951 18:52379867-52379889 CAGCACAAACAGATTAAGACAGG - Intronic
1158489409 18:57896379-57896401 CAAGAGAAAGAGATAGAGAAGGG + Intergenic
1158830610 18:61273777-61273799 GACCAGACACAGATTTATAAAGG + Intergenic
1159077494 18:63698357-63698379 CAAGAGATGAAGATTTAGAATGG - Intronic
1159546708 18:69848363-69848385 CAACAGAAGCAAATTTATAATGG - Exonic
1160483806 18:79269548-79269570 CAACATAAAAAGATTGACAAAGG - Intronic
1160610665 18:80082527-80082549 GAGAACAAACAGATTTAGAAAGG - Intronic
1161642435 19:5432729-5432751 CACCAGAATCAGAATCAGAAAGG + Intergenic
1162757583 19:12869412-12869434 AAAAAGAAACAGGTTTAGAGAGG - Intronic
1162761292 19:12890051-12890073 CAACAGATACACAATCAGAATGG + Intergenic
1163354800 19:16803320-16803342 CAACACCAACAGACTTAGACAGG + Intronic
1164728100 19:30480365-30480387 CAAAACAAACAGACTGAGAAAGG - Intronic
1165634445 19:37328695-37328717 CAACACAAACAGACTAAGACAGG + Intronic
1166476268 19:43127707-43127729 CAACAGACACTGACTAAGAATGG + Intronic
925508013 2:4590976-4590998 CAAGAGAAGTAGAATTAGAAAGG + Intergenic
926033857 2:9618211-9618233 CCACAGAATCATATTTAAAAAGG + Intronic
928765690 2:34642501-34642523 AAACAGAAACAGAAAGAGAAAGG + Intergenic
928819519 2:35343291-35343313 TATCAGAAACAGATTTGGGAGGG - Intergenic
930161179 2:48157389-48157411 CAACAGAAACAAAGAAAGAAAGG + Intergenic
930682691 2:54274080-54274102 CAAAAGAAAGAGGTTTATAATGG + Intronic
932156279 2:69420781-69420803 CAACAAAAAGAGATGAAGAAAGG + Intronic
932857284 2:75249250-75249272 CAAAAGAACTAGAATTAGAAGGG - Intergenic
933211664 2:79577588-79577610 CTACAAAAAAAAATTTAGAATGG - Intronic
933264731 2:80169578-80169600 CCACAGAAACAGATAGAGCAGGG - Intronic
933392675 2:81691712-81691734 TAATAGAAACACATTTAGAGGGG + Intergenic
935046145 2:99484900-99484922 ATAAAGAAACAGATTTAGAGAGG - Intronic
936029792 2:109062096-109062118 GGAGAGAAACAGATTGAGAAGGG - Intergenic
936895842 2:117426644-117426666 CAACAGAAACAAAAATAGAAAGG - Intergenic
937858245 2:126688191-126688213 CAACACAATCAGGGTTAGAAGGG - Intronic
938492709 2:131773137-131773159 CTACAGAGACAGAATTAAAAGGG - Intergenic
938729121 2:134132305-134132327 CAAGATAAACAGTTTCAGAAAGG - Intronic
938801986 2:134772154-134772176 CAAAAGAAGCAGATTTGGGAGGG + Intergenic
940248291 2:151644155-151644177 CAACAGAAGTAAATTTTGAAAGG - Intronic
940724969 2:157326637-157326659 AAAAAGAAAAAGATTTAAAAAGG - Intronic
940876970 2:158907523-158907545 CACCAGAAACATATTTTGGACGG + Intergenic
940901552 2:159130853-159130875 CAACTGACACAGATTAAGAAAGG - Intronic
941595991 2:167477879-167477901 CAACAAAAACACATTTTGAATGG + Intergenic
941886305 2:170531072-170531094 CAGCAGACACAGATCCAGAAAGG - Intronic
942171656 2:173295676-173295698 GGACAGAAACAGATTTTGAGAGG + Intergenic
942686376 2:178536851-178536873 AAACAGAAAGAAATTTTGAAAGG - Intronic
942714442 2:178875262-178875284 CAACAGAAACAGCTCCAGATTGG + Intronic
942966270 2:181896094-181896116 CATAAAGAACAGATTTAGAAAGG - Intronic
943273078 2:185832303-185832325 CAACAGCAGCAGATTGAGCAGGG + Intronic
943429649 2:187783282-187783304 CATCAGAAGCCTATTTAGAACGG - Intergenic
943964466 2:194315035-194315057 CAAAAGAAACAGAATGAAAAGGG - Intergenic
944207950 2:197176638-197176660 AACCAGAAAGAGGTTTAGAAAGG + Intronic
944499350 2:200342271-200342293 CCAGAGATAAAGATTTAGAAAGG + Intronic
945239433 2:207662586-207662608 CAGCAGAAACAGACTAAGATGGG + Intergenic
946637733 2:221748270-221748292 CGACAGAAACATAGATAGAAAGG - Intergenic
947254755 2:228149900-228149922 AAACAGTAAAACATTTAGAAAGG - Intronic
948045440 2:234940222-234940244 CATCAGAAACAGACGTAGGAGGG + Intergenic
1169817585 20:9674133-9674155 CAGCAGAAACAGAATGAGAATGG + Intronic
1170744930 20:19090932-19090954 CAACAGAAACAAAATTTGAGGGG + Intergenic
1171003196 20:21435642-21435664 CATCTGAAACAAATTTTGAAAGG - Intergenic
1171006604 20:21472181-21472203 CAAAGGACACAGATTCAGAAAGG - Intergenic
1173897321 20:46560923-46560945 AGACAGAAAGAGAATTAGAAAGG - Intronic
1175425943 20:58866724-58866746 CAACTGAAACAGATTCATTAGGG + Intronic
1176032561 20:63020617-63020639 CAACAGAAACAGACCCAGAAAGG - Intergenic
1176710013 21:10142629-10142651 CTACAGAGACAGAATTAAAAGGG - Intergenic
1177050123 21:16223032-16223054 CAACAGAAAGATATGTAGAATGG - Intergenic
1177279290 21:18958949-18958971 CTAAAGAAACAGATATAGACAGG - Intergenic
1177483969 21:21731225-21731247 CAACAACAACAAATATAGAAAGG - Intergenic
1177682628 21:24392510-24392532 CAAAAGAAAGAGATTTTGAGTGG + Intergenic
1179917617 21:44487965-44487987 CATCAGAAACAGAGTTGGGAGGG - Intergenic
1180294095 22:10869740-10869762 CTACAGAGACAGAATTAAAAGGG - Intergenic
1180496901 22:15899164-15899186 CTACAGAGACAGAATTAAAAGGG - Intergenic
1181093172 22:20488200-20488222 GAACAGAATCAGAGCTAGAATGG + Intronic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1183145299 22:35985204-35985226 CAACAAAAAAAGAGTAAGAAAGG + Intronic
1184813073 22:46850446-46850468 CAACTGGAACATTTTTAGAATGG - Intronic
1184996593 22:48211586-48211608 CAACAGAAACATATTTCTTATGG + Intergenic
1203309451 22_KI270736v1_random:132408-132430 CAACGGAATGGGATTTAGAATGG + Intergenic
950841429 3:15971959-15971981 CAACAGAAACAAAGATAGATAGG + Intergenic
951237128 3:20249652-20249674 CAACATAATTAGATTTGGAAGGG + Intergenic
952493746 3:33897609-33897631 CATCAGAAACAGAGATGGAAGGG - Intergenic
952699917 3:36316600-36316622 CAACAGAAACAGACTGTGAGAGG - Intergenic
955436541 3:58905909-58905931 GAAGAGAGACAGATTTAAAAAGG - Intronic
955554620 3:60122770-60122792 CAACAGGAAACCATTTAGAAGGG + Intronic
955611574 3:60762999-60763021 GAACAGAAACCCAGTTAGAATGG - Intronic
955969916 3:64428416-64428438 CAAGAGAAATAGAATTAGAAGGG + Intronic
956250965 3:67233263-67233285 GAACTGAAACACATTCAGAAAGG - Intergenic
957147135 3:76439261-76439283 AAACAGAAACAAATGTAAAATGG + Intronic
957147146 3:76439382-76439404 AAACAGAAACAAATGTAAAATGG + Intronic
957711663 3:83867945-83867967 CAAGAAAAAAAAATTTAGAAGGG + Intergenic
958188551 3:90154579-90154601 CAGCAGAAAAATATTTAGATAGG - Intergenic
958411070 3:93816416-93816438 CAGCAGAAAAATATTTAGATAGG - Intergenic
959313583 3:104773146-104773168 CAACAGAAACTGGTTTCCAAAGG - Intergenic
959974836 3:112447114-112447136 AGACACAAACAGATTTAGTAAGG + Intergenic
960337121 3:116431523-116431545 AAACAGAAACAGTTTCATAATGG - Intronic
960543490 3:118886329-118886351 GAACAGAATCAGATATAAAATGG - Intergenic
960903247 3:122572924-122572946 CAACACAAACAGACTAAGACAGG - Exonic
961063639 3:123855192-123855214 CTACAGAAAGAGATTTAAAAAGG - Intronic
961451366 3:127003759-127003781 CCACAGAAACAGATGTATGAAGG + Intronic
961989891 3:131177464-131177486 CTACCAAAACAGATATAGAATGG + Intronic
963091159 3:141485394-141485416 AAACAGAAACAGGTTTAGGAAGG + Intergenic
963439915 3:145326156-145326178 TCAAAGAAACAGAGTTAGAAAGG - Intergenic
963946345 3:151149921-151149943 CAAGAGAACTAGAATTAGAAGGG - Intronic
964928061 3:161981350-161981372 CAACTGATACAGAAATAGAAAGG - Intergenic
965124914 3:164613907-164613929 CAGCTGAAACAGCTTTAGGATGG + Intergenic
965230832 3:166050559-166050581 CAACAGAAGCATAATTAGAGTGG - Intergenic
965357636 3:167696000-167696022 AAAAAAAAACAGATTTAAAAGGG + Intronic
965656025 3:170985813-170985835 GGACAGAAATAGATTTGGAAGGG + Intergenic
965919183 3:173891731-173891753 CAACATAATCAGATTTAGAAAGG + Intronic
966047434 3:175569751-175569773 CAACAGAAATGTATTTATAATGG - Intronic
966192139 3:177281027-177281049 CAACACAAACAGACTAAGACAGG - Intergenic
966276105 3:178172035-178172057 CATCAGAAACAGATTATGTAGGG - Intergenic
966631932 3:182085672-182085694 CAACAGAGACAGATCTGCAAAGG + Intergenic
966832315 3:184020317-184020339 CAACACAAACACATTTTGAGGGG - Intergenic
966887649 3:184385765-184385787 CACCAAAAAAAGACTTAGAAAGG - Intronic
967689727 3:192459664-192459686 TAATAGAATCAAATTTAGAATGG + Intronic
967936268 3:194730389-194730411 CAAAAGAAAAAGAATGAGAAAGG + Intergenic
968430131 4:552584-552606 CAACAGACACCATTTTAGAAAGG - Intergenic
969134118 4:5016332-5016354 CAGCAGAAACAGACTAAGACAGG + Intronic
972958476 4:44421775-44421797 CATCAGAAACAGATGTTGCATGG - Intronic
973292767 4:48485744-48485766 AAAAAGAAACACATTTAGTAAGG - Intronic
973911515 4:55586112-55586134 CAGCAGAAGCAGATTTAAGAGGG - Intronic
974012549 4:56620229-56620251 CAACAGTAACTCATTTAGAGAGG - Intergenic
974454839 4:62115607-62115629 CCTCAGGAACAGAATTAGAATGG + Intergenic
976118447 4:81753898-81753920 CAGCACAAACAGACTAAGAAAGG - Intronic
976779603 4:88744532-88744554 CTACAGATACTGATTTAAAAGGG - Intronic
976881978 4:89937489-89937511 CAACAGAAACAGAGGGAGAGTGG + Intronic
977087905 4:92628306-92628328 CAGCAGTAAAAGATTAAGAAGGG + Intronic
977651040 4:99469687-99469709 CAACAGAAACAAATTTAAGAAGG - Intergenic
977778348 4:100950661-100950683 CAACAGAGACAGAAACAGAAAGG + Intergenic
978070755 4:104465097-104465119 AAAGACAAAGAGATTTAGAATGG - Intergenic
978270819 4:106887910-106887932 ACACAGAAACAGTTTTAGAAAGG + Intergenic
978405571 4:108375334-108375356 CAACTGAAATTGATTTTGAAAGG - Intergenic
979138910 4:117147726-117147748 CACCAGAAACATATTTTTAATGG + Intergenic
979493044 4:121351451-121351473 CTACAAATACAGCTTTAGAAAGG + Intronic
979884010 4:126001184-126001206 TAACAAGAACAGATGTAGAAGGG + Intergenic
979889951 4:126079045-126079067 CAGCAGAAACATATTAAAAATGG - Intergenic
980209095 4:129762586-129762608 CAACACAAAATGAATTAGAATGG - Intergenic
980537818 4:134151816-134151838 CAACAGAAAAATATGTAAAATGG + Intergenic
980918302 4:139055381-139055403 TAAGAGAAACAGATTTTGGAGGG + Intronic
980939354 4:139258845-139258867 TAACAGAAACAGATTTTGTCTGG - Intergenic
981062482 4:140439924-140439946 CAAGAGCAACAGAGTGAGAATGG - Intergenic
981399316 4:144294581-144294603 CTGAAGAAACAGATTTAGACAGG + Intergenic
982080805 4:151787668-151787690 CACCAGGAACAGAATTAGCATGG - Intergenic
982524699 4:156463477-156463499 CAGTAGAAACAGTTCTAGAAGGG - Intergenic
982671480 4:158325080-158325102 CAAAAAAAACAAATTTAGACTGG + Intronic
983481446 4:168279306-168279328 CAACAAAAACAGATTTGGGATGG - Intronic
983621510 4:169766158-169766180 CAGAAGAAACAGATTTGGGAAGG + Intergenic
984210947 4:176847318-176847340 TAACTGAGACAGATTTAAAATGG + Intergenic
984442951 4:179796677-179796699 AAACATAAATTGATTTAGAAGGG - Intergenic
985170992 4:187150125-187150147 CAACACAAACAGACTAAGACAGG - Intergenic
985342541 4:188970664-188970686 CACCAGAAATAGAGCTAGAATGG - Intergenic
986067282 5:4246934-4246956 AAAAAGAAATACATTTAGAATGG - Intergenic
986156355 5:5180151-5180173 CATCAGAGGCAAATTTAGAATGG + Intronic
986495700 5:8339719-8339741 CCACGGAAATAGAGTTAGAAAGG + Intergenic
986697510 5:10371395-10371417 CAAAAGAAAGAGATTTATAATGG + Intronic
987785440 5:22492981-22493003 AAACAGAGAGAGATTGAGAAAGG - Intronic
988395643 5:30694906-30694928 CAATAGAAACTCATGTAGAAAGG - Intergenic
990228388 5:53683070-53683092 CCACAGAAACAGAATTAAAGAGG - Intronic
991572137 5:68066180-68066202 CATCAGAACCAGACATAGAAGGG - Intergenic
993139465 5:84012281-84012303 AACCAAAAACAGATTTAGAGAGG - Intronic
993396948 5:87401457-87401479 AAATAGAGTCAGATTTAGAAAGG - Intronic
994259992 5:97646189-97646211 TAACAGAAACAGATTTGAAAAGG + Intergenic
994416900 5:99483815-99483837 CAATAGAAACAGATTTTGACAGG - Intergenic
994653747 5:102562785-102562807 CAGCAGAAACAGATTAATAGAGG + Intergenic
995300155 5:110570757-110570779 TAACATAATGAGATTTAGAAAGG - Intronic
995306688 5:110659304-110659326 CAGCAGAAAAAGAATGAGAATGG + Intronic
995674339 5:114645224-114645246 CAATAGAACTAGATCTAGAATGG + Intergenic
996168297 5:120254619-120254641 TAACAGACACAGACTAAGAAAGG + Intergenic
996292155 5:121864489-121864511 AAACGGATTCAGATTTAGAAAGG + Intergenic
996945417 5:129061258-129061280 CAACACAAAGAGATTCAGGATGG + Intergenic
997118910 5:131154448-131154470 CAAAAAAAGCAGATTTAGATGGG - Intergenic
997133332 5:131299057-131299079 CAACAGAAAGAAATTGAGAATGG + Intronic
998309794 5:141117240-141117262 CAAGAAAAAAAGATTTAAAAAGG + Intronic
998556492 5:143129880-143129902 CAAGGGAAACAGACTCAGAAGGG + Intronic
999034877 5:148336640-148336662 CACTAGCAACAAATTTAGAAAGG + Intronic
1000170227 5:158695006-158695028 CAAAAGAAACATATATTGAATGG + Intergenic
1000458904 5:161487524-161487546 AAACAGAAAAGGTTTTAGAAAGG + Intronic
1000598966 5:163249149-163249171 AAACAGAAAAATATTTCGAAGGG - Intergenic
1000739809 5:164954350-164954372 TAACTGAAATAGCTTTAGAAGGG + Intergenic
1001418784 5:171570959-171570981 CAACAGAAACAGACTCCCAAAGG - Intergenic
1002353278 5:178600937-178600959 AAAGGGAAAAAGATTTAGAATGG - Intergenic
1002958349 6:1890799-1890821 TAACAGACACAAATTTAGCAGGG + Intronic
1003008977 6:2408895-2408917 CATCAGAAACAGAGTTAATAGGG + Intergenic
1003945737 6:11073702-11073724 CAACTGCAACAGAATTAAAAAGG - Intergenic
1004117067 6:12779675-12779697 AAACAGAAACTGATCAAGAAGGG - Intronic
1005030097 6:21500564-21500586 GGACAGAAACAGATTAAGAAGGG + Intergenic
1006791174 6:36702270-36702292 CATCTGAAACAGACTTCGAAGGG + Intronic
1007230450 6:40344346-40344368 CAGCAGAAAGAGATTTAATAAGG + Intergenic
1008061606 6:47003417-47003439 GATCAGAAAAAGATCTAGAAAGG - Intronic
1008748292 6:54700539-54700561 CAACAAAAACAGATTTTAATTGG - Intergenic
1008940856 6:57044044-57044066 CAACAGAAACAAAGATAGACAGG + Intergenic
1009386505 6:63089537-63089559 CAAATGAAGCAGATTAAGAAGGG + Intergenic
1009627609 6:66156060-66156082 CAAGAGAACTAGAATTAGAATGG + Intergenic
1009865791 6:69396083-69396105 CAACAGAAACAGTTTTTCACAGG + Intergenic
1009882797 6:69590329-69590351 TAAGAGAATGAGATTTAGAAAGG - Intergenic
1010013595 6:71078509-71078531 CAAGAAAAAAAGTTTTAGAATGG - Intergenic
1010662835 6:78590868-78590890 CAAAAGAAAGAGGTTTATAATGG + Intergenic
1011054049 6:83186508-83186530 CAACAGACACAGTGTGAGAAGGG + Intronic
1011194431 6:84766851-84766873 CAGCTCAAACTGATTTAGAAAGG + Intergenic
1011240364 6:85265963-85265985 CAGCAGAAAGGGATTTTGAAAGG - Intergenic
1011538328 6:88402545-88402567 TAACAGAAACAGAGGAAGAAAGG - Intergenic
1011875632 6:91957719-91957741 GAACTTAAACAGATTTACAAAGG - Intergenic
1012123819 6:95400869-95400891 CAACAGCAGCAGATGGAGAAGGG - Intergenic
1012128132 6:95455872-95455894 CAACAGAAACAGAGATAAATAGG + Intergenic
1013701169 6:112771082-112771104 CAACCAAAACTGATTTACAAAGG + Intergenic
1013797626 6:113904785-113904807 CTTCAGAGACATATTTAGAAGGG + Intergenic
1014609940 6:123529934-123529956 CAGCAGAAGCAAATTAAGAAAGG - Intronic
1014755265 6:125295963-125295985 TAGAAGAAACAAATTTAGAAAGG - Intronic
1014925540 6:127266589-127266611 CAACAGAAAGAGATTTGGGGTGG - Exonic
1015285974 6:131486965-131486987 CAACACAAACAGACTAAGACAGG - Intergenic
1016693389 6:146965064-146965086 AAACTGAAACATATTTAAAAGGG + Intergenic
1016804130 6:148195851-148195873 CAACAGAAATGGATTTTGGAGGG + Intergenic
1017576448 6:155810327-155810349 GAACAGAAAAAGATCTGGAAAGG + Intergenic
1019011204 6:168844818-168844840 CAACAGAACCAGATAGAGAGAGG - Intergenic
1020044486 7:5031061-5031083 CAGTAGAAACAGATCTAGCATGG - Intronic
1020158104 7:5744059-5744081 CAACAGAAACAAATATACAAGGG + Intronic
1020289844 7:6715083-6715105 CATTAGAAACAGATCTAGCATGG - Intergenic
1020492323 7:8802917-8802939 CAGCATAAACAGACTAAGAATGG - Intergenic
1020956205 7:14742162-14742184 AGACAAAAACAGATTTTGAAAGG - Intronic
1021195656 7:17671728-17671750 CAATTGAAAAAGATTTACAATGG + Intergenic
1021310581 7:19091004-19091026 CAACAGGCACAGAATTGGAAAGG + Intronic
1022365871 7:29715622-29715644 AAATAAAAACAGATTCAGAAAGG - Intergenic
1022695025 7:32696625-32696647 AAATACAAACAGATTCAGAAAGG + Intergenic
1022931928 7:35126729-35126751 AAACAAAAACAGATTCAGAAAGG + Intergenic
1023366246 7:39466208-39466230 CAAAAGAAAAAAATATAGAAGGG + Intronic
1023612868 7:41988742-41988764 CAACAGAAACAGGCTAAGACAGG + Intronic
1024470490 7:49764740-49764762 CATCAGAACCAGATATGGAAGGG + Intergenic
1024472747 7:49780225-49780247 CAATAGACACAGAATCAGAATGG - Intronic
1026107005 7:67429360-67429382 TAACCCAAACAGATTTTGAATGG + Intergenic
1026256014 7:68712028-68712050 CAAGAGAAATAGAATTAAAATGG - Intergenic
1026763342 7:73143210-73143232 CAACAAAAACAGACTAAGACAGG - Intergenic
1027033085 7:74906123-74906145 CATTAGAAACAGATCTAGCACGG - Intergenic
1027039813 7:74953000-74953022 CAACAAAAACAGACTAAGACAGG - Intergenic
1027083828 7:75249380-75249402 CAACAAAAACAGACTAAGACAGG + Intergenic
1027681381 7:81225847-81225869 CAAAAGCAACAGATTTACAGTGG - Intergenic
1027728019 7:81831625-81831647 CAAAAGGAACTGATATAGAAAGG - Intergenic
1027810769 7:82894368-82894390 CAAAAGAAAGAGGTTTATAATGG + Intronic
1028256552 7:88605420-88605442 CAACAAATACAGATTTTCAAGGG - Intergenic
1028847502 7:95498384-95498406 CATTACAAACATATTTAGAATGG - Intronic
1028996821 7:97110097-97110119 CAACAGAAATAGAATTTAAAAGG + Intergenic
1029182852 7:98716975-98716997 AAACATAAAAAGAGTTAGAAGGG - Intergenic
1029391422 7:100277221-100277243 CAACAAAAATAGATTAAGACAGG + Intergenic
1029827814 7:103219207-103219229 AAACAAAAACAGATTCAGAAAGG + Intergenic
1030161918 7:106518011-106518033 CCACAGAAACAGCTTTTGCAAGG + Intergenic
1030359200 7:108577852-108577874 AAAAAGAAACATATTTAGCAAGG - Intergenic
1030570725 7:111219786-111219808 CAATAGAAACAGGTTAACAAAGG - Intronic
1030862811 7:114658004-114658026 CAAGAGAAAAAGACTTAAAAAGG - Intronic
1030964429 7:115971838-115971860 AAACAGAGACAAATTTACAAAGG + Intronic
1032330740 7:130976791-130976813 CAACAGAACTTGATTTAAAATGG + Intergenic
1032413202 7:131715287-131715309 CAACAGAAACAGATCGGCAAAGG - Intergenic
1032701503 7:134383887-134383909 CAACACAAACAGACTAAGACAGG + Intergenic
1033535647 7:142309525-142309547 CAACAGAAAAATATTTGGAGAGG + Intergenic
1036909161 8:12738774-12738796 CAACAGAAACAGGTTAAGATAGG + Intronic
1037103948 8:15081817-15081839 CAACAGAGACAGAGATACAAAGG + Intronic
1037181710 8:16014821-16014843 CAATAGAGCCAGGTTTAGAATGG - Intergenic
1037278723 8:17211448-17211470 CAACAAAAAGAACTTTAGAATGG - Intronic
1038814303 8:30885489-30885511 CAAAAGAAAGAGGTTTATAATGG - Intronic
1039107069 8:34001409-34001431 CAACTGAAGCATATTTATAAGGG + Intergenic
1039414742 8:37384248-37384270 CAACAGAAATAGAACCAGAAGGG + Intergenic
1041009098 8:53523985-53524007 CAGCAGACACAGAGTTAAAAGGG - Intergenic
1041639051 8:60177236-60177258 CAACAACAACAAATTTATAAAGG + Intergenic
1041733053 8:61082256-61082278 AAAGAGAAAAAGATTTAAAAAGG + Intronic
1042493044 8:69423703-69423725 TAACAGAAACAAATTTAGAGGGG - Intergenic
1042890895 8:73609062-73609084 CAGGAGAAAGAGGTTTAGAAGGG + Intronic
1043169844 8:76952113-76952135 CAATAGAAACATATTTGGAGGGG - Intergenic
1043609737 8:82047706-82047728 CAAGAGCAACACATTTACAAAGG + Intergenic
1044847713 8:96398476-96398498 CAAAAGAAAGAGGTTTATAATGG + Intergenic
1045808024 8:106188437-106188459 CAACACACACAGAAGTAGAAAGG - Intergenic
1046421222 8:113985511-113985533 GAACACAACCAGATTTACAATGG + Intergenic
1046435297 8:114179664-114179686 AAACAGAAAATGATATAGAATGG - Intergenic
1048687654 8:136922493-136922515 CAAAAGAAAAACATTTAAAATGG - Intergenic
1048943365 8:139422395-139422417 CAACACAGACAGATTGAAAATGG + Intergenic
1050539319 9:6656632-6656654 CAAGAGAAGCAGAATTATAAAGG + Intergenic
1050970649 9:11868449-11868471 CCAAAGAAACAGAAATAGAATGG + Intergenic
1051056067 9:12987862-12987884 AAACATAAACAGCTTAAGAATGG - Intergenic
1051836921 9:21349371-21349393 CAATGGAAACAGATTTGGAATGG - Intergenic
1052248554 9:26369136-26369158 CAACAGAAAAAGATATTGTAAGG - Intergenic
1052580988 9:30353606-30353628 CCACAGAAATAGGTTTAGAGTGG + Intergenic
1052747818 9:32458006-32458028 CTAAAGAAGCAGACTTAGAAAGG + Intronic
1053646991 9:40128322-40128344 CTACAGAGACAGAATTAAAAGGG - Intergenic
1054327993 9:63726287-63726309 CTACAGAGACAGAATTAAAAGGG - Intergenic
1054537588 9:66247848-66247870 CTACAGAGACAGAATTAAAAGGG + Intergenic
1054841121 9:69741305-69741327 GAAGAGAAACAGATTTAGGTAGG - Intronic
1055594526 9:77851557-77851579 CAAAAGCAAAACATTTAGAATGG - Intronic
1056841045 9:89998155-89998177 CACCAAAAACAGAGTTGGAAAGG + Intergenic
1057058686 9:91983798-91983820 CATCAGAAACAGATGCAGACAGG + Intergenic
1057923878 9:99125107-99125129 ATACAGAAACACATTTAAAATGG - Intronic
1058219543 9:102280252-102280274 TAACAGAATCACATGTAGAAAGG + Intergenic
1058231077 9:102426334-102426356 AAACATAAACAGAAGTAGAAAGG + Intergenic
1058886580 9:109326158-109326180 CAACTTAAAGAGAATTAGAATGG + Intergenic
1058953449 9:109924716-109924738 CAGCAGAAACAGTTATAAAATGG - Intronic
1059034278 9:110736620-110736642 CAACAGAAACAGACCTACAGTGG - Intronic
1060458820 9:123828041-123828063 CAATAGAAACAGACCCAGAAGGG + Intronic
1060575150 9:124685111-124685133 ATGAAGAAACAGATTTAGAAGGG - Intronic
1060603392 9:124893411-124893433 CAAAAGAAACAGACTCACAAGGG - Intronic
1061435904 9:130561837-130561859 CAAAAAAAACAGAATTAGATGGG - Intergenic
1202794774 9_KI270719v1_random:111626-111648 CTACAGAGACAGAATTAAAAGGG - Intergenic
1186066575 X:5772604-5772626 AAACAGAAACAGAGGTATAAAGG + Intergenic
1186319007 X:8403824-8403846 GAACAGAAACACATTATGAATGG - Intergenic
1187094629 X:16134408-16134430 AAATAGAAACAGATTTATAGAGG - Intronic
1187348417 X:18489113-18489135 CAAAAAAAACAGACTTAAAAAGG - Intronic
1187800274 X:23054161-23054183 CATCAGAACCAGATATAGTAGGG + Intergenic
1188089385 X:25944460-25944482 CAGCAGAAACAGTTATAAAAAGG + Intergenic
1188855514 X:35190335-35190357 CAAGAGAACTAGAATTAGAAGGG - Intergenic
1188891432 X:35615533-35615555 AAAAATAAACATATTTAGAAGGG - Intergenic
1189096980 X:38150849-38150871 CAACACAAACATATTTAGATGGG + Intronic
1189616822 X:42792895-42792917 CAGCAAAAACAGATTTTGAGAGG + Intergenic
1189977514 X:46477485-46477507 CAAGAGGAACAGATCCAGAAGGG + Intronic
1189984489 X:46542117-46542139 CTACAAATACAGAATTAGAAGGG + Intronic
1191084784 X:56553544-56553566 CAACAGATAAAAAATTAGAATGG - Intergenic
1191189604 X:57652252-57652274 AGACAAAAACAGATTTTGAAAGG - Intergenic
1192002397 X:67167875-67167897 GAACAGAGAGAGATATAGAAAGG - Intergenic
1192070375 X:67933560-67933582 CAAAGGAAACAGTTTTAAAAGGG + Intergenic
1193804272 X:85974947-85974969 CAAAGGACACATATTTAGAATGG + Intronic
1193880308 X:86912811-86912833 CAATAGCAACATATTTATAATGG + Intergenic
1193974241 X:88098092-88098114 CAACAGAATTAGTTTTAAAAAGG - Intergenic
1194579753 X:95657533-95657555 GAACAAAAAAAGATTTAGCATGG + Intergenic
1195430731 X:104786316-104786338 GAACAGATACAGATTGAGGAAGG - Intronic
1196260870 X:113579693-113579715 AAACAAGAACAGATTGAGAATGG + Intergenic
1197555906 X:127952969-127952991 CAACAGAAACATAAATAGAGTGG - Intergenic
1198469747 X:136935098-136935120 CAGCAGACACAGAGTTAAAAAGG - Intergenic
1199085069 X:143618518-143618540 AAACAGAAACAGTTTTAGTGAGG + Intergenic
1199106728 X:143876843-143876865 CAAAAGAAAGAGGTTTATAATGG - Intergenic
1199166352 X:144679851-144679873 CAACAAAATTAGTTTTAGAAAGG + Intergenic
1199496465 X:148457949-148457971 TAACAGAAAAAGATTTATAGAGG + Intergenic
1200561769 Y:4712710-4712732 CAACAGAAGCAGTCTTAAAAGGG - Intergenic
1201478173 Y:14407137-14407159 CAACAGAAAGAGACAAAGAATGG + Intergenic