ID: 1091947062

View in Genome Browser
Species Human (GRCh38)
Location 12:4556105-4556127
Sequence GGGGATAGTAATATCTGTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091947061_1091947062 -9 Left 1091947061 12:4556091-4556113 CCTTCTCTGAGAGTGGGGATAGT 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1091947062 12:4556105-4556127 GGGGATAGTAATATCTGTATTGG 0: 1
1: 0
2: 0
3: 7
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091947062 Original CRISPR GGGGATAGTAATATCTGTAT TGG Intronic
903414737 1:23174418-23174440 GGAGATATTAATATTTGAATTGG - Intronic
904333101 1:29778389-29778411 GGGTATACAAATATCTGTTTGGG + Intergenic
909625751 1:77713954-77713976 AGGGATAGGGATACCTGTATTGG - Intronic
921278093 1:213538947-213538969 GGGGATAATAATATCTGTCCTGG - Intergenic
1066485881 10:35844167-35844189 GGAGACAGTAATCTTTGTATGGG - Intergenic
1066695133 10:38070473-38070495 GAGGATATTAAAATATGTATGGG + Intergenic
1066997374 10:42576714-42576736 GAGGATATTAAAATATGTATGGG - Intronic
1069439456 10:68414963-68414985 GGTGATAGAATTTTCTGTATGGG + Exonic
1072739740 10:97902212-97902234 GGGAATAGTAATAGCTGCCTGGG + Intronic
1074633004 10:115279892-115279914 GGGTATATTTTTATCTGTATAGG - Intronic
1086740244 11:90358802-90358824 GAGGATATTAATATTTGAATTGG - Intergenic
1089033014 11:115353331-115353353 GTGGCTAGTGATGTCTGTATTGG - Intronic
1090191696 11:124775237-124775259 GGGTATAAAAATATGTGTATGGG - Intronic
1091947062 12:4556105-4556127 GGGGATAGTAATATCTGTATTGG + Intronic
1094264040 12:28535269-28535291 GGGCATAATGATATCTATATAGG + Intronic
1095926972 12:47588255-47588277 GTGGATAGAAAAATCTGGATGGG + Intergenic
1100185627 12:92136028-92136050 AGGGTCACTAATATCTGTATCGG + Intronic
1100899152 12:99218542-99218564 GGGGACAGTATTTTCTGTTTAGG - Intronic
1104196410 12:126543275-126543297 GGGGAGTGTAATATTGGTATAGG + Intergenic
1105455867 13:20540812-20540834 AAAGATAGTAATACCTGTATTGG - Intergenic
1106961197 13:35000040-35000062 GGGTACAGTAATATCTTTAAGGG + Intronic
1111640118 13:90958392-90958414 GGGGAAACTAATATCTAAATAGG - Intergenic
1112196123 13:97228167-97228189 GGGGATAGTATTAACTTTGTGGG - Intronic
1112578749 13:100660392-100660414 GGAGACAGTAATAGCAGTATAGG - Intronic
1115098603 14:29670704-29670726 GGGGTTAGGTATATGTGTATTGG - Intronic
1117707061 14:58481386-58481408 AGGTATATTAATATCTGAATGGG - Intronic
1120763006 14:88302980-88303002 GGGGATGGTATTATCCTTATTGG - Intronic
1122168266 14:99848232-99848254 GGGGTTAGTATTAACTGTAGTGG - Intronic
1123880215 15:24671880-24671902 GGATATGGTAATTTCTGTATGGG - Intergenic
1133438389 16:5800095-5800117 GGGGAGAGAAATATGTATATAGG + Intergenic
1137569530 16:49556382-49556404 TGGGATAGAAAAATCTGTATGGG - Intronic
1139378015 16:66512872-66512894 GGCCATAGGAATATCTGTTTGGG - Intronic
1144796895 17:17897814-17897836 GAGGATAGTAAAATCTCTTTTGG + Intronic
1145289338 17:21530838-21530860 TGGCATAGTAATCTATGTATTGG + Exonic
1148807270 17:50270359-50270381 GTGGACACTAATATCTGTAATGG - Intergenic
1153840284 18:9001224-9001246 GGGTAAAGAAATATCTCTATAGG - Intergenic
1158371242 18:56806965-56806987 GGGGATGTTAAGATGTGTATTGG - Intronic
1167060683 19:47143847-47143869 GGGGTTAGTAATATCTCCCTTGG + Intronic
1168151726 19:54452728-54452750 TGGGATAGTAGTAGCTGTAGGGG - Exonic
929485967 2:42354935-42354957 GGGAATAGTAATATCTTCATAGG - Intronic
935573916 2:104689559-104689581 GGGAATAGTCATACCTGTCTAGG - Intergenic
936090070 2:109495835-109495857 GGGGATAATAATACATGTCTGGG + Intronic
940074490 2:149725951-149725973 GGGGCAAGTAAGATCTGTACGGG + Intergenic
940826652 2:158420094-158420116 GATGATAGTAAAATGTGTATTGG + Intronic
941108247 2:161387299-161387321 GGGAATGGTAATATCTGTAATGG + Intronic
942281659 2:174370524-174370546 GGGGATAAGAATTTGTGTATAGG - Intronic
944752633 2:202726732-202726754 GGGAATAATAATACCTGTCTCGG + Intronic
945565992 2:211400199-211400221 GGGGATAATAATGCCTGTGTTGG + Intronic
947831100 2:233142418-233142440 GGGGACAGTAATATCTCTGCAGG + Intronic
948969561 2:241414584-241414606 GGGTAAGGTAAGATCTGTATGGG - Intronic
1169431847 20:5543385-5543407 GAGGAAAGTAATATTAGTATAGG - Intergenic
1170855893 20:20053612-20053634 GTTGAAAGTAATATCTGCATTGG - Intronic
1182068013 22:27443895-27443917 GGGGATAGTGAAATTTGCATTGG - Intergenic
949208023 3:1463999-1464021 GGGAATAGGAGTATCTGTTTAGG - Intergenic
949685185 3:6561418-6561440 GAAGATGGTGATATCTGTATTGG + Intergenic
952961236 3:38590483-38590505 GGGGATAATAATAACTCCATAGG + Intronic
957460135 3:80506491-80506513 GGGAATACTATTATCTGTTTAGG + Intergenic
962010986 3:131390585-131390607 GGGGAGAAGAAGATCTGTATGGG + Intergenic
963852916 3:150225712-150225734 GGGGATAGTGATAACTATATTGG - Intergenic
965470666 3:169086576-169086598 GATGATAGTAATAACAGTATTGG + Intronic
970724994 4:19033342-19033364 GGGGATAGTAACTGCTTTATGGG - Intergenic
973320265 4:48802965-48802987 GGAAATAACAATATCTGTATGGG + Intergenic
976961261 4:90978267-90978289 GAGGATAATAATATTTTTATTGG + Intronic
977599511 4:98920731-98920753 GTGGATTGTAAAATCTGTTTTGG - Intronic
981657372 4:147127134-147127156 GGCAATAGAAATCTCTGTATTGG - Intergenic
981691455 4:147513955-147513977 GGGGATATTAACATCTGGAATGG + Intronic
982696581 4:158609097-158609119 AGGGATACAAATATCTGTTTGGG + Intronic
988876601 5:35454001-35454023 GAGGATATTAATATCTGCAGAGG - Intergenic
989481130 5:41931429-41931451 GGTAACAGTAAGATCTGTATAGG + Intronic
990445452 5:55889773-55889795 GGGGATGTTCATATCTGTGTAGG + Intronic
996047155 5:118886060-118886082 GTGGATAGTGGTTTCTGTATGGG - Intronic
996860713 5:128062659-128062681 GGAGGTAGTAATATCTGTCTTGG - Intergenic
997682700 5:135767231-135767253 GGTGATATTACTATCTATATTGG + Intergenic
998439039 5:142140852-142140874 GGGGAGAAGAATATATGTATAGG - Intronic
998671868 5:144362592-144362614 GGGAATAGTAATATAATTATTGG + Intronic
999907567 5:156159118-156159140 AGGAATGGTAATATCTGTCTTGG + Intronic
1000996999 5:167969512-167969534 GGGGACAAGAACATCTGTATTGG - Intronic
1001332040 5:170769276-170769298 GGGGAAATTTATATCTGTAATGG - Intronic
1003071693 6:2950048-2950070 GGGGATAGGAATCTGTGTTTGGG - Intronic
1010846543 6:80716166-80716188 GGACATAGGAATATCTGTGTGGG + Intergenic
1012528768 6:100209491-100209513 GTGGTTAGTAATGTCTGCATTGG - Intergenic
1016586994 6:145699475-145699497 GGAGAAGGTAATATCAGTATGGG + Intronic
1025758784 7:64370999-64371021 GGGGATAGTAACATATGGCTGGG + Intergenic
1026375423 7:69745705-69745727 GGGGGAAGTAATATTTGTGTGGG + Intronic
1027837147 7:83259100-83259122 GGGGCTTTTAATATCTGTGTGGG + Intergenic
1031623171 7:123960642-123960664 GGCGGTAGTAATATTTGTACAGG - Intronic
1032327103 7:130939707-130939729 GAGTATTGTAATCTCTGTATTGG - Intergenic
1036701805 8:11018049-11018071 GGGGATTGTCACATGTGTATAGG - Intronic
1037106943 8:15120356-15120378 GGGGAAAATACTACCTGTATAGG - Intronic
1038660584 8:29493248-29493270 GTGGATAATAACATCTGTACTGG + Intergenic
1040710494 8:50182927-50182949 GGGGAGAATAATATATTTATTGG - Intronic
1043504648 8:80890297-80890319 GGAGATAGTAATATAATTATAGG - Intergenic
1043933884 8:86121108-86121130 GGAGATAATGCTATCTGTATAGG - Intronic
1046780314 8:118207952-118207974 GGAGATAGAAATATCTCTTTTGG + Intronic
1051857716 9:21588477-21588499 GGGCATAGTGATATTTGTAGTGG + Intergenic
1052422069 9:28255268-28255290 GTGTATAGTAACATCTGTACAGG + Intronic
1056076323 9:83044587-83044609 GGGGAATATAATATATGTATAGG + Intronic
1058401360 9:104623937-104623959 GGGAATAGTATTATCTGTTTAGG - Intergenic
1059968399 9:119639025-119639047 TGGGAAAGTAATATGTGTAGTGG - Intergenic
1186363585 X:8868662-8868684 GGGGATGCCACTATCTGTATAGG - Intergenic
1191607993 X:63082448-63082470 GGGGCTACTAATCTCTGGATGGG - Intergenic
1194423545 X:93707715-93707737 GGAGATGGTGATGTCTGTATAGG - Intronic
1198159665 X:133995084-133995106 GGGGGTGCTAATATCTGTTTAGG - Intergenic