ID: 1091949310

View in Genome Browser
Species Human (GRCh38)
Location 12:4580016-4580038
Sequence CTCATTTTACAGATGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 990
Summary {0: 1, 1: 2, 2: 28, 3: 208, 4: 751}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091949310_1091949314 3 Left 1091949310 12:4580016-4580038 CCTTTCTCCATCTGTAAAATGAG 0: 1
1: 2
2: 28
3: 208
4: 751
Right 1091949314 12:4580042-4580064 ATTATACTACACATGCCCTAAGG 0: 1
1: 0
2: 0
3: 4
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091949310 Original CRISPR CTCATTTTACAGATGGAGAA AGG (reversed) Intronic
900932939 1:5748022-5748044 CCCATTTTACATGTGGGGAAAGG - Intergenic
901094138 1:6664771-6664793 CTCATTTTACAGAAGAGAAAAGG + Intronic
901303787 1:8217799-8217821 TTAATTTTGCAGCTGGAGAAGGG - Intergenic
901566441 1:10119714-10119736 TTCATTTTACAGGTGAGGAAGGG - Intronic
902281304 1:15376625-15376647 ATCATTTTACAGCTGGGAAATGG - Intronic
902398426 1:16144695-16144717 CTCATTTTACAGATGGGGGTGGG + Intronic
902419324 1:16265566-16265588 CTCATTTTACAGATGAATAATGG + Intronic
902497409 1:16883177-16883199 TTCATTATACAGCTGGACAATGG + Intronic
902533188 1:17103529-17103551 CCCATTTTACAGATAGACCAAGG + Intronic
902607725 1:17578118-17578140 CCCATTTTACAGAAGGAAAAAGG - Intronic
902667723 1:17951343-17951365 TCCATTTTACAGATGAGGAAAGG - Intergenic
902692992 1:18121889-18121911 CTCATTTTCCAGTTGAATAAGGG + Intronic
903134375 1:21299828-21299850 CCCATTTTACAGATGAAAAATGG - Intronic
903338389 1:22639448-22639470 CCCATTTTACAGGCGGAGCATGG - Exonic
903705050 1:25279566-25279588 CCCATTTTAGAGATGGGGAAAGG - Intronic
903722178 1:25413755-25413777 CCCATTTTAGAGAGGGGGAAAGG + Intronic
904235340 1:29112730-29112752 TTCATCTTACAGATGCAAAATGG - Intronic
904416704 1:30366265-30366287 ATCATTTTACAGAATGGGAATGG - Intergenic
904455942 1:30648105-30648127 CCCATTTCCCAGATGGAGAACGG + Intergenic
904510495 1:31002107-31002129 CTCATTTTGCAGATGAATTAAGG + Intronic
904594975 1:31638256-31638278 CCCATTTTACAGATGGGGGAGGG + Intronic
904751689 1:32744566-32744588 CTCACTTTACAGATGGGAAATGG + Intronic
905000999 1:34669427-34669449 CAAATGTTACAGATAGAGAAGGG - Intergenic
905115715 1:35638859-35638881 ATCATTTTATACTTGGAGAAAGG + Intronic
905166760 1:36087629-36087651 CTCATATTCCTGATGGAGCAAGG + Intronic
905860366 1:41346552-41346574 CTCATTTCACAGATGAAAAGAGG + Intergenic
906542817 1:46601238-46601260 TTCATTTTATAGATGGGGAAAGG - Intronic
906825269 1:48972529-48972551 CCCATTTTATAGGTGAAGAAAGG + Intronic
906958585 1:50398554-50398576 CTAATTTTTCATATAGAGAAAGG - Intergenic
907126142 1:52052864-52052886 CCCATTTTGCAGATGAGGAACGG + Intronic
907258124 1:53195860-53195882 CCCATTTTACAGAAGAAGACAGG - Intergenic
907318498 1:53588010-53588032 CCCATTTTATAGATGGGGAAAGG - Intronic
907534724 1:55140570-55140592 CTCATTTTAAAAAAGAAGAATGG + Intronic
907574047 1:55509900-55509922 CCCATTTTACAGGTGAGGAAAGG + Intergenic
907625308 1:56023753-56023775 CTCATTTCACAGTTAGAAAATGG + Intergenic
907825912 1:58016741-58016763 AGCTTATTACAGATGGAGAATGG - Intronic
907861190 1:58355252-58355274 GCCACTTTACAGATGGAGACTGG - Intronic
907940018 1:59078504-59078526 CTCATTTTACAAATGAGGAATGG - Intergenic
908034419 1:60036591-60036613 CCCATTTTACAGTTGGAGAATGG + Intronic
908048103 1:60194545-60194567 CTCACTTTCCAGATGAAGAATGG + Intergenic
908082436 1:60595689-60595711 CTGACTTTAAAGATGGAGAGAGG - Intergenic
908439348 1:64137962-64137984 CTCATTTCACAGATGAAGAAGGG - Intronic
908443001 1:64173630-64173652 GCTATTTTACAGATGGAGAAAGG - Intronic
908507342 1:64817936-64817958 TTCATTATACAAATGGAGAAGGG + Intronic
908536205 1:65080039-65080061 CTCATTTTACAGTTGAAGAAAGG - Intergenic
908577782 1:65479160-65479182 GTAATTTTACAAATGGAAAAAGG + Intronic
908726884 1:67185952-67185974 CCCATTTTACAGATGGCGTGGGG + Intronic
908776275 1:67643662-67643684 TTCATTTTAAAGATGTAGTATGG - Intergenic
908859143 1:68463724-68463746 CTGATTTAACAGAGGGAGGAGGG - Intergenic
909512217 1:76466452-76466474 CTAATTTGACAGATGTAAAATGG - Intronic
909658312 1:78055175-78055197 CTCATGTAACAGAAGGGGAAAGG + Intronic
909684136 1:78326992-78327014 CTGATTTTACAAATGGGGAAAGG - Intronic
909903409 1:81166667-81166689 TTCACTTAACAAATGGAGAAAGG - Intergenic
909974302 1:82027279-82027301 CGTATCTGACAGATGGAGAAGGG - Intergenic
910550744 1:88471352-88471374 CCCATTTTAAAGATGGAGGAAGG - Intergenic
911658881 1:100477005-100477027 TGCATTTTAAAGATGGAGTAAGG + Intronic
911684571 1:100760176-100760198 CACATTTTAAAGATGGAGACAGG + Intergenic
912200177 1:107448358-107448380 CCCATTTAACAGATGATGAATGG + Intronic
912244853 1:107950692-107950714 CTCATGTTACAGAAGGTGAAGGG + Intronic
912453427 1:109782206-109782228 CTAATTTGACAGATGAAAAATGG + Intergenic
912482034 1:109990247-109990269 CCCATTTTACAGATGAGAAAAGG - Intronic
912591599 1:110826297-110826319 CTCAATTTACAAATGGGCAAGGG + Intergenic
912944568 1:114074442-114074464 CTAATTTTACAAATGAACAAAGG + Intergenic
913002386 1:114593847-114593869 TTCATTTTACAGATGAGAAAAGG - Intronic
913392623 1:118331308-118331330 CCCATTTTACACATAAAGAAAGG - Intergenic
913657757 1:120977489-120977511 TTCATTATACAGCTGGACAATGG - Intergenic
914009106 1:143760573-143760595 TTCATTTTACAGCTGGACAATGG - Intergenic
914647736 1:149669225-149669247 TTCATTATACAGCTGGACAATGG - Intergenic
915028723 1:152857528-152857550 CTCATTTTACAGAAAAAGTAAGG - Intergenic
915132045 1:153702193-153702215 CTCATTTTATTTATGGAAAAGGG + Intergenic
915289121 1:154870946-154870968 CTCCTTTTACAGATGAAAATTGG + Intergenic
915475786 1:156152130-156152152 CCCATTTTACAGATCAAGAAGGG - Intronic
916314862 1:163437960-163437982 CTCGGTTTACAGACGGGGAATGG - Intergenic
916501032 1:165387061-165387083 TTCTTTTTGGAGATGGAGAAAGG + Intergenic
916802469 1:168227282-168227304 CTCATTTCACAGATGGGGAACGG - Intronic
916833020 1:168512507-168512529 TCCATTTTACAGATGAGGAAGGG + Intergenic
916972719 1:170041830-170041852 CCCTTTTTACAGATTGGGAAGGG - Intronic
917203201 1:172540099-172540121 TCCATTTTAAAGATGAAGAAAGG + Intronic
917454508 1:175174477-175174499 CTCATTTCTCAGATGAGGAAAGG - Intronic
917690409 1:177462585-177462607 TAGGTTTTACAGATGGAGAAAGG + Intergenic
917863038 1:179166422-179166444 CTCATTTAACAAGTGGAAAAAGG + Intronic
917869721 1:179230013-179230035 CTCATTTGACAGGTGGAGGTGGG - Intergenic
918132513 1:181642197-181642219 CTCATTTTACAGAAGAACCAAGG - Intronic
918547657 1:185703570-185703592 CTCATTTGACTTAAGGAGAAAGG - Intergenic
919508374 1:198429199-198429221 TTCATTTTACAGATGAACCAGGG + Intergenic
919837932 1:201589314-201589336 CCCATGTTACAGATAGGGAAAGG + Intergenic
920045957 1:203132529-203132551 TTCATTTAACAGATGGTGAAGGG - Intronic
920133194 1:203748699-203748721 CTCATTTGAAAGAGGGAGTAAGG + Intergenic
920320854 1:205121390-205121412 CTCATTGAACAGATGAATAAAGG - Intronic
920349698 1:205329660-205329682 CTCCTTCTACAGATGGAACAGGG + Intergenic
921240326 1:213174266-213174288 CCCATTTTACAGATGAATAAAGG - Intronic
921281343 1:213571163-213571185 TCCATTTTACAGATAGAGACAGG - Intergenic
921571958 1:216790340-216790362 TCCATTTTACAGATGGGGAATGG - Intronic
921803336 1:219426918-219426940 CTTATTTCACAAATGAAGAAAGG + Intergenic
922092106 1:222405774-222405796 CTCATATTAAAAATGGATAATGG - Intergenic
922403104 1:225281282-225281304 CTGGCTTTACAGATGGATAAAGG - Intronic
922433402 1:225579076-225579098 CCCATTTTACAGATAGGAAATGG + Intronic
922570619 1:226632782-226632804 CTTCTTTCACAGATGGAGTAAGG + Exonic
922867890 1:228876051-228876073 CTCATTTTGGAACTGGAGAAGGG + Intergenic
923195698 1:231664593-231664615 CTGCTTTTGAAGATGGAGAAAGG + Intronic
923488025 1:234455018-234455040 CTGGTTTTGAAGATGGAGAAAGG + Intronic
923714112 1:236410510-236410532 CCCATCCTACAGATGCAGAAAGG + Intronic
924032671 1:239902311-239902333 CTAGTTTTATAGATGAAGAAAGG + Intronic
924489153 1:244518101-244518123 CTCATGATACATAAGGAGAAGGG - Intronic
924500558 1:244634321-244634343 CCCATTCTACAGATACAGAACGG - Intronic
1063005628 10:1967981-1968003 CTCATTTTATAAATGGAGAAAGG + Intergenic
1063197628 10:3758401-3758423 ATCATTTTGCAGATAAAGAAAGG + Intergenic
1063430928 10:5987574-5987596 TCCATTTTACAGATGAGGAAAGG - Intergenic
1064185796 10:13161137-13161159 CTCACTGCACAGATGGTGAAGGG + Intergenic
1064700149 10:18010213-18010235 CTCATCTTTTGGATGGAGAAAGG - Intronic
1064727555 10:18296928-18296950 CTCATTTTACAGATGAATGACGG - Intronic
1064897983 10:20261016-20261038 CTCAATTTAAAAATGGAGAAAGG - Intronic
1065364190 10:24918808-24918830 ATCATTTTACAAATGAACAAAGG + Intronic
1065878130 10:30014781-30014803 CCCATTTTACTGTTGGTGAAGGG - Exonic
1066593757 10:37025381-37025403 CCCATTTTATAGATGCAAAAAGG - Intergenic
1067166080 10:43867629-43867651 CTCATTTTCCTTATGGTGAAGGG - Intergenic
1067522697 10:47020247-47020269 CTCATTTCAAAGATGGACATGGG + Intergenic
1067921599 10:50464315-50464337 CTGACTTTAAAGATGGAAAAGGG + Intronic
1068302248 10:55159032-55159054 CTCATTTTAAAAATGATGAAAGG + Intronic
1069086573 10:64146843-64146865 CTGACTTTGCAGATGGAGGAAGG + Intergenic
1069832927 10:71291918-71291940 CCCATCTCACAGATGGGGAAAGG + Intronic
1069863617 10:71486620-71486642 CTCATTTTCTAGATGGGAAACGG + Intronic
1069920017 10:71810768-71810790 CCCATGTTACAGATGGGGAGAGG - Intronic
1070422414 10:76250168-76250190 ATCATTCTTCAGCTGGAGAAGGG + Intronic
1070443818 10:76474543-76474565 CTCATTTTAAAAATGGTCAAAGG + Intronic
1070593953 10:77819629-77819651 CCCTTTTTACAAATGGAGACAGG - Intronic
1070658574 10:78288713-78288735 CCCATTTTACAGATGGGGAAGGG - Intergenic
1070688734 10:78509275-78509297 CCCATTTCACAGATGGACAAGGG + Intergenic
1070780755 10:79136195-79136217 CTCATTTTACAGATAAGAAAAGG - Intronic
1071134151 10:82434198-82434220 CTCTTTTTAGAGATTGTGAATGG + Intronic
1071586132 10:86823369-86823391 CTCATTTTACAGATTGGGTACGG + Intronic
1071821191 10:89282750-89282772 CACTCTTTACAGATGAAGAACGG + Intronic
1072418204 10:95266542-95266564 TTCATTTTAAAGATGAAAAATGG - Intronic
1072615797 10:97048267-97048289 CTAATTTTACAGGTGGGGACGGG + Intronic
1072877406 10:99187559-99187581 CTCAATTTAAAGATAAAGAAAGG + Intronic
1073322941 10:102626611-102626633 CTCATTTTACAGATGACAAAGGG - Intronic
1073468027 10:103705540-103705562 CCCATTTTACAGATGAGAAATGG + Intronic
1073727373 10:106248924-106248946 CTCATTTTACAGAAGGAACTTGG - Intergenic
1073786403 10:106895079-106895101 CTCATCTGACAGATGAAGTAGGG - Intronic
1073847961 10:107580725-107580747 CTCATTCTAGAGCTGGAGGAGGG - Intergenic
1073910604 10:108338614-108338636 CTTATTTTACAGATATGGAAAGG + Intergenic
1073918828 10:108435740-108435762 CCCATTTTACAGTTGAAGAATGG + Intergenic
1074072288 10:110084614-110084636 CTCATTTCTCATATGGAGAAAGG - Intronic
1074156307 10:110802930-110802952 CTCAGTTTACAGATCAGGAAAGG + Intronic
1074265666 10:111900719-111900741 CTCATTCAACACTTGGAGAATGG + Intergenic
1074604294 10:114945104-114945126 CCCATTTTACAGAAGAAGAAAGG + Intronic
1074806017 10:117053430-117053452 CTCAATTTAAAAATGGGGAAAGG + Intronic
1074889436 10:117722843-117722865 CTCCTTTTGCAGATGGTGAAAGG + Intergenic
1075106061 10:119540906-119540928 CCCACTTTGCAGGTGGAGAAAGG + Intronic
1075411459 10:122231604-122231626 CCCATTTTACAGATGGGAGATGG + Intronic
1075926634 10:126256415-126256437 CCCATTTTACAGATGGAGACTGG - Intronic
1076357047 10:129860861-129860883 CTCAATTTTCAGATGATGAATGG + Intronic
1078402979 11:11044494-11044516 CTCATTTTACAGTTGAGGGAAGG - Intergenic
1078427383 11:11262896-11262918 CCCATTTTATAGATGAGGAAAGG - Intergenic
1078465199 11:11545102-11545124 CCCATTTTACAGATGATAAAAGG + Intronic
1078558146 11:12347585-12347607 TTCAATTTACAGATGCAGAAGGG - Intronic
1079425051 11:20332492-20332514 CCCATTTTACAGAAGAGGAAGGG - Intergenic
1079641722 11:22813976-22813998 CTGATTTTGAAGATGGAGGAAGG - Intronic
1079858805 11:25641714-25641736 CTCCTGTTAAAGCTGGAGAATGG - Intergenic
1079881690 11:25935960-25935982 CTCATTTGAGAGATGGAATAGGG + Intergenic
1081412297 11:42774062-42774084 CTCATTTTTAAAATGGATAATGG + Intergenic
1081659695 11:44880417-44880439 CTCATTTTACAGATGAGGAGAGG - Intronic
1082884392 11:58067722-58067744 CTCATTTTACAAGTGGGAAATGG + Intronic
1083049172 11:59761700-59761722 CTCAGTTTCCAGATGGAGACTGG - Intronic
1083566153 11:63718142-63718164 CTCATTTTTCAGATTCAGGAAGG + Intronic
1083607519 11:63987525-63987547 CCCATTTTACAGTTGAGGAAAGG + Intronic
1083831364 11:65236031-65236053 CTTATTTTACAGATGAGGACAGG + Intergenic
1083837307 11:65279423-65279445 GTCATTTTACAGAAGCAGGAAGG - Intronic
1084521688 11:69666974-69666996 CTCATTTTACAGAGGAGGGAGGG - Exonic
1084877084 11:72140976-72140998 CTCATCTTACAGGTGGGGAAAGG + Intergenic
1084958600 11:72704312-72704334 CTCTTCTTACAGCTGGGGAATGG - Exonic
1085365646 11:75940768-75940790 CCCATTTTGCAGATGAAGCACGG + Intronic
1085393364 11:76193845-76193867 CCCTTTTTACAGATAGGGAAAGG - Intronic
1085679304 11:78556604-78556626 CTAGTTTTATAGATGGAAAAAGG - Intronic
1085894554 11:80622946-80622968 CCCATTTTATAGATGCAGAAAGG + Intergenic
1086337727 11:85815638-85815660 TGCATTTTACAGATGAAGATAGG + Intergenic
1087529792 11:99365201-99365223 CTCATTTTAAAGATGGGAAAAGG - Intronic
1088418471 11:109616515-109616537 CTCATTTTAAAAATGGGCAAAGG + Intergenic
1088906603 11:114159855-114159877 CCCATTTTACAGATGACCAAGGG + Intronic
1089523977 11:119084774-119084796 CTCATGTCACAGCTGGGGAATGG + Intergenic
1089568112 11:119383105-119383127 TTCATTTTACAGATGGATATTGG + Intergenic
1089774972 11:120829723-120829745 CCCATTCTACAGATGAAGAATGG + Intronic
1090248903 11:125237381-125237403 CTCCTTGGAGAGATGGAGAAGGG - Intronic
1090254293 11:125272565-125272587 TCCATGTTACAGAGGGAGAAGGG - Intronic
1090474284 11:127005258-127005280 ATCATTTAATAGATGAAGAAAGG - Intergenic
1090646550 11:128771105-128771127 CCCATTTTACAGATGCAAAATGG - Intronic
1091144515 11:133265973-133265995 CTCCGTTTACAAAAGGAGAAGGG + Intronic
1091341913 11:134822706-134822728 CTCACTTTATAGATGAGGAAAGG + Intergenic
1091424790 12:378077-378099 CTACTGTTAAAGATGGAGAATGG - Intronic
1091627795 12:2136342-2136364 CCCATTTTAAAGATGAGGAAGGG + Intronic
1091660476 12:2379595-2379617 CTCATTTTACTGGTGAGGAAGGG + Intronic
1091949310 12:4580016-4580038 CTCATTTTACAGATGGAGAAAGG - Intronic
1091987122 12:4919749-4919771 CCAATTTTACAGATGTAAAAAGG + Intronic
1092178886 12:6431115-6431137 TTCTTTTTGCAGATAGAGAAAGG - Intergenic
1092776826 12:11950928-11950950 CCCATTTTATAGAGGCAGAAAGG - Intergenic
1093118268 12:15237125-15237147 CTCATTTTAAAGACAAAGAATGG + Intronic
1093516335 12:19990874-19990896 CTGGTTTTGAAGATGGAGAAAGG + Intergenic
1093767062 12:22976521-22976543 TTCATTTTACAGATAGCCAAGGG + Intergenic
1093985624 12:25529038-25529060 CTCAATTTACCGATTGTGAAGGG - Intronic
1094504570 12:31050785-31050807 CTCATGACACAGATGAAGAAAGG - Intergenic
1094623938 12:32105877-32105899 CTCAGTTTACAGGGGGTGAAAGG - Intergenic
1094793488 12:33942275-33942297 CTGACTTTAAAGATGTAGAATGG + Intergenic
1095104762 12:38219026-38219048 CTGACTTTAAAGATGTAGAATGG + Intergenic
1095822483 12:46493631-46493653 ATCCTTTTACAGAGGGAGAGTGG + Intergenic
1096021148 12:48326614-48326636 CTGATTTTAAAGATGGGAAAAGG + Intergenic
1096242393 12:49966361-49966383 CCCATTTTACAGATGAAGAGAGG - Intergenic
1096525952 12:52210542-52210564 CTTATTTTATAGATTGAAAAAGG - Intergenic
1096536079 12:52275691-52275713 CCCATTTCACAGATGGAGAAAGG + Intronic
1096583056 12:52600890-52600912 CCCATTTTACAAATGGAAAAGGG + Intronic
1096906512 12:54941650-54941672 CTCAGTTTACCCATTGAGAATGG + Intergenic
1097545262 12:60991775-60991797 CTCATTTTAAAGCTGAAGAAGGG + Intergenic
1097780683 12:63700385-63700407 CTTATTTTACAGATGAGAAAAGG - Intergenic
1097997786 12:65908509-65908531 CTCATTTTGAAAATGTAGAAAGG - Intronic
1098144009 12:67480210-67480232 CTCACTTTCAAGGTGGAGAAAGG - Intergenic
1098184404 12:67880727-67880749 TTCATTTTCCATCTGGAGAATGG + Intergenic
1098413287 12:70204295-70204317 AAAATTTTACAGATGGAGGAAGG + Intergenic
1098575454 12:72036854-72036876 CTTAGTTTACAGGTTGAGAAAGG + Intronic
1098954103 12:76670690-76670712 CTCATTTTACATATGGACAGAGG - Intergenic
1099091598 12:78317217-78317239 TTCATCCTACAGATGGAAAATGG + Intergenic
1099293454 12:80801384-80801406 CTCGTTTTGAAGATGGAGGAAGG + Intronic
1099318092 12:81109918-81109940 CTCATTTTACAGGGAGAGGATGG + Intronic
1100014692 12:89994957-89994979 CCCATTTTACAGATAAACAAAGG - Intergenic
1100226839 12:92566095-92566117 CTCATTTTACAGACGAGAAACGG - Intergenic
1100588699 12:96003769-96003791 CTCCTTTGAAAGATGGAGAAAGG - Intronic
1101376342 12:104174397-104174419 CCCATTTTAGGGATGGAGAAAGG + Intergenic
1101477195 12:105062234-105062256 CCCATTTTACTGATGCAGAAAGG + Intronic
1101652907 12:106693976-106693998 CCCATTTCACAGAAGGGGAACGG + Intronic
1101837162 12:108303729-108303751 TGCATTTTACAGACGGAGCAAGG + Intronic
1102448128 12:113019351-113019373 CACATTTTACAGAGGGGGAAAGG + Intergenic
1102635041 12:114315956-114315978 CCTATTCTACAGATGAAGAAAGG - Intergenic
1102705954 12:114880626-114880648 CCCATCTTACAGATGAAGAAAGG + Intergenic
1102898019 12:116614090-116614112 CGCATTTTACAGATGATCAATGG - Intergenic
1102917623 12:116766443-116766465 CCCATTTTACAGATGAGGAAAGG + Intronic
1102973414 12:117189563-117189585 CCCATTTTAGAGATGGGGAATGG - Intronic
1103015693 12:117492841-117492863 CTGACTTTGAAGATGGAGAAGGG + Intronic
1103149131 12:118621836-118621858 CCCATTTTACAGATGAGGAAAGG - Intergenic
1103242023 12:119421637-119421659 CCCATTTCACAGATGGGGATTGG + Intronic
1103304994 12:119956988-119957010 CTGGCTTTGCAGATGGAGAAGGG + Intergenic
1103620190 12:122182853-122182875 CCCATCTGACAGATGGAGAAAGG - Intronic
1104123211 12:125819101-125819123 CTCATTCTAGGGATGGTGAAGGG + Intergenic
1104752677 12:131250056-131250078 CTTATTTCCCAGAGGGAGAAGGG - Intergenic
1105343830 13:19555169-19555191 CTCATTTTATAGGTGGGGAAAGG + Intergenic
1105536212 13:21266445-21266467 CTCATTTTATAGGTGGGGAAAGG - Intergenic
1105634294 13:22202485-22202507 CTCATTTTACAGAGAGGAAAAGG + Intergenic
1105730145 13:23205681-23205703 TCCATTTCACTGATGGAGAAGGG + Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106958941 13:34975039-34975061 CACAATTTACATATGGGGAAAGG + Intronic
1107343437 13:39434286-39434308 GACATTTTACAGAAGAAGAATGG + Intronic
1107407055 13:40124461-40124483 TACATTTTACTGATAGAGAATGG + Intergenic
1108168846 13:47720611-47720633 CCCATTTTACAGAGGAGGAAAGG - Intergenic
1108420982 13:50249226-50249248 TTGATTTTACAGATGAGGAATGG + Intronic
1108505970 13:51112714-51112736 ATCAATTCACAGATGAAGAAGGG + Intergenic
1108520357 13:51241542-51241564 CTCATTTTACAGTTGGGGTCAGG - Intronic
1108552942 13:51564708-51564730 CACATGCTACAGATGAAGAAAGG + Intergenic
1108666285 13:52634831-52634853 CTCATTTTACAGTTGGGGAAAGG - Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109766109 13:66900266-66900288 CTTATTCTACAGATGGGAAAAGG - Intronic
1110182750 13:72636819-72636841 CTCATTTTACACATGAGGACTGG + Intergenic
1110310534 13:74044254-74044276 CCCATTTTACAGATGAGGAATGG - Intronic
1110656005 13:78000512-78000534 CTCAATTAAAAGATGCAGAATGG + Intergenic
1111617076 13:90673265-90673287 CTCATTTTTCAGAGGCAGATAGG - Intergenic
1111902588 13:94218206-94218228 CCCATTTTACAGGAGGAAAAGGG - Intronic
1111951542 13:94712566-94712588 CTCATTTGACAGAAGCAGATGGG + Intergenic
1112752170 13:102594608-102594630 TTCATTTTACAGCTGTACAAAGG + Intergenic
1113120037 13:106916389-106916411 CTCATTTTGAAGATGAAGACAGG + Intergenic
1113156251 13:107326278-107326300 CTCATTTATCAGAAGGAGAATGG - Intronic
1113634581 13:111910702-111910724 CTCATTTTATAGAGGAAGAATGG + Intergenic
1114509421 14:23245244-23245266 CTCACTCTAGAGATGGAGTAAGG + Intronic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1115161679 14:30403449-30403471 CTCATTTTAAAGAAGAGGAAAGG - Intergenic
1115745724 14:36435459-36435481 CTCATGTTACCGTTGAAGAAAGG - Intergenic
1115749818 14:36477868-36477890 TTTATTTTATAGATGGAGGAGGG - Intronic
1115814501 14:37148489-37148511 CTTATTTTACTGATGGTGGAGGG - Intronic
1116030791 14:39568755-39568777 CACATTTTGCAGAGGGAGAAGGG + Intergenic
1116620900 14:47201847-47201869 CCCATTTTACAGATGATGAGTGG - Intronic
1117128743 14:52662627-52662649 TTCATATTACAGATGGGGTAGGG + Intronic
1117319705 14:54609268-54609290 CTGACTTCAAAGATGGAGAAAGG + Intronic
1117331239 14:54713932-54713954 CTCATTTTATAGATGAGGAAAGG - Intronic
1117522068 14:56560796-56560818 CTCATTTCACTGGTGGAGATAGG + Intronic
1117814445 14:59582622-59582644 CCCATTGTACAGATGAAGAATGG - Intergenic
1118065218 14:62183615-62183637 CTCATTTTACAGATGATAGAAGG + Intergenic
1118213875 14:63790001-63790023 CTCATTCTACAGAGGGAGGGTGG - Intergenic
1118270933 14:64341439-64341461 CTAGTTTTAAAGATGGAGGAAGG + Intergenic
1118274753 14:64375811-64375833 CACATTTTAGAAATGGAAAAGGG + Intergenic
1118401180 14:65380864-65380886 CTAATTTTCCAGATGGTAAATGG - Intergenic
1118838832 14:69496092-69496114 CGCATTTTATAGAGGAAGAAAGG + Intronic
1119206255 14:72796200-72796222 CTCCTTTTATAGATGGGGAAAGG - Intronic
1119250350 14:73147354-73147376 CTTATTTTACAAAAGGAGAAGGG - Intronic
1119624752 14:76163206-76163228 CTCATGTTACAAATGGAAAGGGG - Intronic
1119654943 14:76410553-76410575 CCCATTTTACAGATGGAGAATGG + Intronic
1119701468 14:76758533-76758555 TCCATTTTACAGATGAAGAAAGG - Intergenic
1119921191 14:78447822-78447844 CCCATTTCACAGATGAAGAAAGG - Intronic
1120272954 14:82337325-82337347 CCCATTTTACAAATGAAGACAGG - Intergenic
1121548435 14:94780030-94780052 CCCATTTTACAGATGAGAAAAGG - Intergenic
1121553143 14:94817563-94817585 CTCATAATACAGACGGAGACAGG - Intergenic
1122105243 14:99448197-99448219 CTCATTTTTCAAATGGGGAATGG - Intronic
1122171926 14:99883718-99883740 CTCATTTAGCAAATGAAGAAGGG - Intronic
1122458449 14:101875660-101875682 CTCACTTTACAAATGGGGAAAGG + Intronic
1123439608 15:20281052-20281074 CTCATTTTACAGCTGGGAATGGG + Intergenic
1125070143 15:35545277-35545299 CTCAGTTTATAGATTGAGTATGG + Intronic
1125415273 15:39445896-39445918 TTCATTTTATAGATGAGGAAAGG - Intergenic
1125916033 15:43488368-43488390 GACATTTTACACATGAAGAATGG + Intronic
1126105550 15:45144756-45144778 CTCCTTTTACAGAAGAGGAAAGG - Intronic
1126275577 15:46875581-46875603 CACCTTTCACAGATGGAGAGAGG + Intergenic
1126838181 15:52688901-52688923 CTATTTTTACAGATGGAGGAAGG + Intronic
1127966983 15:63929862-63929884 CTCATTTTACAAGGGGGGAAGGG - Intronic
1128411811 15:67406782-67406804 CTCTCTTTACAGATAGAGAAAGG - Intronic
1128869127 15:71138981-71139003 CCCATTTTACAGATGAAGAAAGG + Intronic
1129136008 15:73552255-73552277 CACAAATTATAGATGGAGAAGGG - Intronic
1129177464 15:73850253-73850275 CCCACATTACAGATGAAGAAAGG + Intergenic
1129236748 15:74228318-74228340 CTCATTTTACAGATGAGGAAAGG - Intergenic
1129654952 15:77517897-77517919 CCCATTTTACAGAAGAAGAAAGG - Intergenic
1129670106 15:77602986-77603008 ATCATCTTATAGATGGGGAAAGG + Intergenic
1130102783 15:80906517-80906539 CTCATGTTACAGAAGGATGAAGG - Intronic
1130175600 15:81565979-81566001 CACATTTTACAGATAAAGAAAGG + Intergenic
1130284561 15:82544297-82544319 CTCATTTTGCAGATGAAAAGCGG - Exonic
1130346687 15:83054019-83054041 CTCTTTTTAAAGATGAAAAATGG - Intronic
1130735716 15:86546492-86546514 CTCATTTTACAGATGGCAGAAGG - Intronic
1130759782 15:86806619-86806641 CCCATTTTACAGATTAGGAAGGG - Intronic
1131421073 15:92305842-92305864 CTCATTTTCCGGATGAGGAAGGG - Intergenic
1131697740 15:94897647-94897669 GTCATTTTTCAGGTTGAGAAAGG + Intergenic
1131786140 15:95912977-95912999 CCCATTTTATAGATTGTGAAAGG - Intergenic
1132057659 15:98664342-98664364 TCCATTTTACAGATGAGGAAAGG - Intronic
1132096062 15:98985749-98985771 CCCATTTTGCAGATGAGGAAAGG - Intronic
1132163519 15:99564879-99564901 CCCATTTTACAGATGAGGAAAGG - Intergenic
1132355308 15:101167406-101167428 CTCAGTTTACAGATGAGGACTGG - Intergenic
1133465862 16:6026367-6026389 CCCATTTTGCAGATAGAGAGTGG + Intronic
1133625798 16:7569395-7569417 CTGATTTTGAAGATGGGGAAAGG - Intronic
1133796029 16:9047182-9047204 ATCATTGTGCAGCTGGAGAAAGG + Intergenic
1133921754 16:10159627-10159649 CCCATTTTACAGATGAGGAAAGG + Intronic
1134307830 16:13049313-13049335 ATTATTTTACAGATGGGGAAAGG - Intronic
1134381745 16:13733714-13733736 CTCATTTTTCAGGTGATGAACGG + Intergenic
1135353105 16:21746580-21746602 CTGATTTTGGAGATGGAGGATGG + Intronic
1135451592 16:22562703-22562725 CTGATTTTGGAGATGGAGGATGG + Intergenic
1135644291 16:24147785-24147807 CCTATTTTACAGATGAAGAAGGG - Intronic
1135940816 16:26820117-26820139 CTCCTTTTACAGATGGGGAAAGG - Intergenic
1136125069 16:28173391-28173413 CTCATTTTACAAAGAAAGAAAGG + Intronic
1136504971 16:30697429-30697451 CCCATTTTACAGATGAAGTTTGG - Intergenic
1136610797 16:31363786-31363808 CCCATTTTACAGATGGAATCTGG + Intronic
1136845561 16:33573346-33573368 CTCATTTTACAGCTGGGAATGGG - Intergenic
1138293652 16:55868859-55868881 CTCATTTCACAGCTGGAAAATGG - Intronic
1138326495 16:56175676-56175698 CTCAATTTAAAAATGGACAAAGG - Intergenic
1138347536 16:56329229-56329251 TTAATTTTAAAGATGGGGAATGG - Intronic
1138456893 16:57126290-57126312 CTCCTTTTAGAGCTGGGGAATGG + Intronic
1138505494 16:57476342-57476364 CCCATTTTATAGATGGGGAAAGG + Intronic
1139338245 16:66248685-66248707 TCCATTTTACAAATGGAAAATGG - Intergenic
1139751081 16:69109174-69109196 CACATTTTACAGATGACGTAAGG + Intronic
1139790999 16:69435166-69435188 TCCATTTTACAGAGGGAAAAGGG - Intronic
1139971140 16:70775983-70776005 CCCATTGTACAGGTGAAGAAAGG - Intronic
1140259451 16:73364919-73364941 CTCATTCTACAGGTGGACCATGG - Intergenic
1140280764 16:73553460-73553482 CTCACCTTTTAGATGGAGAAGGG - Intergenic
1140458133 16:75116316-75116338 CCCATTTTACAGATGAGAAATGG + Intronic
1140909317 16:79437599-79437621 CTCATTTTACAGCTGAGGAAAGG + Intergenic
1140937879 16:79691563-79691585 CTAGTTTTCAAGATGGAGAAAGG + Intergenic
1140972222 16:80024408-80024430 AACATTTTACAGATGGATAAAGG + Intergenic
1141143715 16:81514508-81514530 CCCATTTTGCAGATGAAGAATGG - Intronic
1141324934 16:83047870-83047892 TTCATTTTACAGGTGAATAAAGG + Intronic
1141522521 16:84590483-84590505 CCCATTTCACAGATGGGAAATGG + Intronic
1141552760 16:84817196-84817218 TTCATTTCACAGATGGGGCATGG + Intergenic
1142189196 16:88709827-88709849 CTGCTTTTAAAGATGGAGATTGG + Intronic
1203107269 16_KI270728v1_random:1421999-1422021 CTCATTTTACAGCTGGGAATGGG - Intergenic
1143349507 17:6277112-6277134 TCCATTTTACAGATGAGGAAAGG - Intergenic
1143874859 17:9983976-9983998 CTCATTTTACATAGGAGGAAAGG - Intronic
1144095388 17:11895725-11895747 CAAATTATACAAATGGAGAATGG - Intronic
1144182157 17:12762553-12762575 CTCAGGTTACAGAATGAGAAGGG + Intronic
1144260050 17:13509772-13509794 TTCATTTCACAGATGTTGAAAGG + Intronic
1144342806 17:14324155-14324177 CTGTTTTTACACATGGAGACAGG + Intronic
1144754530 17:17671168-17671190 CCCATTTTACAGATGAGGAGAGG - Intergenic
1145063665 17:19747842-19747864 TGCATTTTACAGATGAGGAAAGG + Intronic
1145724963 17:27111525-27111547 CTCATTTTAAAAATGATGAAAGG - Intergenic
1146032146 17:29375446-29375468 CTCATTTTACAGATGGGGAAAGG + Intergenic
1146176900 17:30670938-30670960 CTCATTTTATAAATGAGGAAAGG - Intergenic
1146923604 17:36729543-36729565 CCCATTTCACAGATGGGAAAGGG - Intergenic
1147155069 17:38540508-38540530 CCCATTGTACAGACGAAGAAAGG + Intronic
1147469550 17:40647264-40647286 CCCATTTTACAGATGAAACAAGG + Intronic
1148575068 17:48704708-48704730 TTCATTTGCCAGATGGACAAAGG + Intergenic
1148867409 17:50635634-50635656 CCCTTCTCACAGATGGAGAAAGG + Intronic
1149349335 17:55771524-55771546 CTCAGTCTACAGAAGGAAAAAGG + Intronic
1150012411 17:61517302-61517324 CCCATTTTACAGATGAGAAATGG + Intergenic
1150016629 17:61563995-61564017 CTTATTTTAAAGATGAAAAAAGG + Intergenic
1150333015 17:64309540-64309562 CTCATTTCATTGATGAAGAAAGG + Intergenic
1150337800 17:64343097-64343119 CTCCTTTTACAGATGGGGAAAGG + Intronic
1150621897 17:66814043-66814065 CCCATTTTACAGAAGAAGAAAGG + Intergenic
1151288851 17:73133830-73133852 CCCATCTTACAGATGGGGAAGGG + Intergenic
1152049889 17:77965139-77965161 CCCATTTTACAGATGAGCAAAGG + Intergenic
1152108424 17:78343647-78343669 CCCATTGTACAGATGGGGAGCGG + Intergenic
1152251609 17:79215473-79215495 CTCAAGGAACAGATGGAGAAAGG - Intronic
1152700814 17:81818065-81818087 CTCATTTTACAGAAGTACAGGGG + Intergenic
1152797976 17:82317255-82317277 CTCATTTAAGAGAAGGAAAAAGG - Intronic
1153189962 18:2527123-2527145 GCTATTTTACAGATGGTGAAAGG - Intergenic
1153929974 18:9869773-9869795 CTCCTTTTACAGAAGGAGCATGG + Intergenic
1153956859 18:10103854-10103876 CTAATGTTAGAGATGAAGAAAGG - Intergenic
1154260262 18:12825431-12825453 TCCATTTTACAGATGAGGAAGGG + Intronic
1155417774 18:25618812-25618834 CCCATTTTACAGATGAGAAAAGG + Intergenic
1155825465 18:30436960-30436982 CTCATATTACAAATGCAAAATGG - Intergenic
1156366699 18:36435059-36435081 CTTAATTTACTGATGGTGAAGGG + Intronic
1156497640 18:37536606-37536628 TGCATTTTACAGATGCAGATAGG + Intronic
1156695582 18:39762241-39762263 CTGACTTTGAAGATGGAGAAGGG - Intergenic
1156885114 18:42126311-42126333 CTCATTTTACATATGGAAACAGG + Intergenic
1157120899 18:44910294-44910316 CTCATTCAAGAGATGGCGAAGGG + Intronic
1157147595 18:45180274-45180296 CTCATTTTACAGATGAACAGAGG - Intergenic
1157992027 18:52508820-52508842 CACAATTTACAGATGAAAAAAGG + Intronic
1158149233 18:54348570-54348592 CCCATTTTACAAATGAATAAGGG - Intronic
1158203989 18:54970676-54970698 ATCATTTCAAAAATGGAGAAAGG + Intergenic
1158325643 18:56311535-56311557 CCCATTTCACAGATGAAGAAAGG + Intergenic
1158673865 18:59500986-59501008 CCCAGTTTACAGGTGGACAAAGG + Intronic
1159099188 18:63939394-63939416 GTGACTTTACAGATGGAGAGTGG - Intergenic
1159863717 18:73680547-73680569 CTCATTTTACAGATGAAAGGAGG + Intergenic
1159944772 18:74436289-74436311 CTCATTTTACACAAGGCGACAGG + Exonic
1160105726 18:75973991-75974013 CCCATTTTACAGATGAGGAAAGG - Intergenic
1162418871 19:10554349-10554371 CCCATTTTACAGACAGGGAAAGG + Intronic
1162981919 19:14245972-14245994 CTCATTTTATAAATGAGGAAAGG + Intergenic
1164744916 19:30604758-30604780 CTTATTTTTCACATGAAGAACGG + Intronic
1165102317 19:33446275-33446297 CTCTTCTTAAAGCTGGAGAAAGG - Intronic
1165167687 19:33868613-33868635 TTCATTTTTCAAATGGAAAAAGG - Intergenic
1165296577 19:34931460-34931482 TTTATTCTACAGTTGGAGAAAGG + Intronic
1165425179 19:35741447-35741469 CTTATTTTAGGGATGGAAAAGGG - Intronic
1165762643 19:38330727-38330749 TACATTTTACAGATGGGGGAAGG + Intergenic
1166130600 19:40743600-40743622 CCCAATTTCCAGATGGGGAAAGG + Intronic
1166164660 19:40978872-40978894 CTCATTTTACAGATGAGAAACGG + Intergenic
1167459545 19:49617329-49617351 CTCATTTTAAAGATGGGGGCTGG + Intronic
1168496993 19:56861598-56861620 CCTATTTTACAGATGAGGAAGGG + Intergenic
925215318 2:2089639-2089661 CTCATTATACAGATGGACGGAGG + Intronic
925793876 2:7522021-7522043 TTCATTTTACAGATGTCAAAGGG - Intergenic
926766392 2:16326006-16326028 CTCATTTTACAGATGAAAAGTGG + Intergenic
926793855 2:16602680-16602702 CTCATTTTACAAAAAAAGAATGG + Intronic
927266324 2:21156160-21156182 CCCATTTTAAAAATGGGGAAAGG + Intergenic
927283353 2:21331086-21331108 CTGATTTTACAAATAGAGAATGG + Intergenic
927393727 2:22625508-22625530 CCCATTTTACAGAAGGAAAATGG + Intergenic
928243901 2:29610728-29610750 CTCATTTTACAGCTAGAGTCTGG + Intronic
928416270 2:31094657-31094679 CCCATTTTGCACATAGAGAATGG + Intronic
928480407 2:31677039-31677061 CTTATTTTACAGATGAAGATAGG - Intergenic
928537625 2:32255612-32255634 TTCATTTTATAGGTGAAGAAAGG - Intronic
928546059 2:32330239-32330261 TTCATGTTGCAGATGGATAAAGG - Intergenic
929018279 2:37524193-37524215 CTCATTTTTCAAATGGAGGAGGG + Intergenic
929040846 2:37743042-37743064 CCCATTTTACAGATGAGGATAGG - Intergenic
929588013 2:43128088-43128110 CCCATTTGACAGATGAGGAAAGG + Intergenic
929863993 2:45702359-45702381 CCCATTTCACAGGTGCAGAAAGG - Intronic
929873819 2:45779527-45779549 CTCAGTTCACAAATGGAGCAAGG - Intronic
930336196 2:50049386-50049408 CTTATTTTACAGAGGCAGCAAGG + Intronic
930408473 2:50993252-50993274 TTCATTTTACAAAATGAGAATGG + Intronic
930614168 2:53576253-53576275 CACATCTGACAGCTGGAGAAAGG - Intronic
930698710 2:54438188-54438210 ATCATTTTACAGATGAGCAAAGG + Intergenic
930734260 2:54759114-54759136 CACATTTCACAAATGGAAAATGG - Intronic
930867076 2:56132647-56132669 CTCATGTTACAGATGAGAAACGG + Intergenic
931122605 2:59236657-59236679 CCCATTTTACAGACACAGAAAGG - Intergenic
931217182 2:60257047-60257069 CTGATTTTCCAGGTGGGGAAAGG + Intergenic
931946181 2:67310458-67310480 TTTATTTTATAGATGAAGAAAGG - Intergenic
932031577 2:68191858-68191880 GTCATTTTATAGATAGAAAATGG - Intronic
932123166 2:69119632-69119654 CTCATATTTCAGATGCAAAATGG - Intronic
932192942 2:69756376-69756398 TTCATTTTACAGTTGAGGAAAGG - Intronic
932275959 2:70452503-70452525 CTCCTTTTACAGATGAAAAAGGG + Intronic
932299498 2:70656153-70656175 CTTACTTTACAGATGAAGTAAGG - Intronic
932420983 2:71601212-71601234 CTCATTTTACAGCAGGGGAGTGG - Intronic
932597450 2:73102873-73102895 CTCATTTTACAGAGGTGAAATGG - Intronic
932731926 2:74227554-74227576 CCCATTTTACAGATGGGGACCGG - Exonic
933478554 2:82823388-82823410 CTCATTTTGTAGATGTAGACTGG - Intergenic
933772409 2:85752919-85752941 CTCGTTTTACAGGTGAGGAAAGG + Intronic
934737679 2:96698243-96698265 CTCATTGTGAAGATGGAGCAGGG + Intergenic
935116094 2:100137740-100137762 CTCCTTTCACCTATGGAGAACGG - Intronic
935863421 2:107359191-107359213 CTCATTTTACAGAGGTGGATGGG + Intergenic
937103162 2:119287085-119287107 TGCATCTTACAGATGGGGAAGGG - Intergenic
937249945 2:120517279-120517301 CCCATTTCACAGATGGGGGAAGG + Intergenic
937659586 2:124415175-124415197 CTCTTTATCCAGATGGAGAATGG - Intronic
937689216 2:124735779-124735801 CTCATCTTACAGATAAAAAATGG - Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
937845153 2:126571541-126571563 CTCATTTTACAGATGAAGCACGG + Intergenic
938420226 2:131139827-131139849 ATCATTTTACAGATGGGCAAAGG + Intronic
939008967 2:136822534-136822556 CCCATTTTACAGATGAAGGAAGG + Intronic
939087686 2:137741263-137741285 ATCATTGTAAAGATGGTGAATGG - Intergenic
939639080 2:144617601-144617623 CCCTTTTTACAGATGAGGAAAGG + Intergenic
939718446 2:145615774-145615796 CTCACTTTGAAGATGGAGAAAGG + Intergenic
939814216 2:146874108-146874130 CTCAGTGTACAGATGGAGCAAGG - Intergenic
940474042 2:154137795-154137817 ATCAGTTTACAGACGGTGAAAGG + Intronic
940757660 2:157701592-157701614 CTCCTTTTAAAGATATAGAATGG + Intergenic
940862926 2:158788769-158788791 CCCATTTTACAGGTGGGAAAAGG - Intergenic
940986322 2:160055706-160055728 CTTCTTTTACAGATGAAGAAGGG - Intronic
941083694 2:161091843-161091865 CACATTTTTCATATGTAGAAGGG - Intergenic
941140310 2:161772412-161772434 TTGATTTTAAAGATGGTGAATGG + Intronic
941614842 2:167707559-167707581 CTGGTTTTCAAGATGGAGAAAGG - Intergenic
941902490 2:170691715-170691737 CTCATTAAACAGATGATGAATGG - Intergenic
941946192 2:171100483-171100505 CTCATGTTACAGAAGGTCAAAGG - Intronic
941950803 2:171154376-171154398 CTCATTTTACAGATGAAAAGAGG + Intronic
942240669 2:173962243-173962265 ATCAGTTTACAGATGGGGGAGGG - Intronic
942413192 2:175732981-175733003 CTGACTTTACAAATGAAGAAAGG + Intergenic
942596739 2:177598809-177598831 CTCTTTTCACAGATGGAAAAAGG + Intergenic
943171983 2:184413476-184413498 ATAATTTCACAGATGGAAAATGG + Intergenic
943417422 2:187625859-187625881 CTCATTTTTCAGATAGGAAATGG + Intergenic
944021329 2:195108027-195108049 CTCATTTTCTAGATGGGGCATGG - Intergenic
944869379 2:203894520-203894542 CTAATTTTACAAATGGATACAGG + Intergenic
944870693 2:203908862-203908884 CCCATTTCACAGATGAAGACTGG - Intergenic
946022984 2:216654396-216654418 GTCCTTTTACAGATGAACAATGG + Intronic
946055389 2:216896462-216896484 CCCATTTTACAGATAAGGAAAGG + Intergenic
946412977 2:219524624-219524646 GCCATTTTACAGATGAAAAATGG + Intronic
947332944 2:229049211-229049233 CTAATTTGACAGATGAAAAATGG + Intronic
948131664 2:235605328-235605350 CCCATTTTACCGATGAGGAAAGG + Intronic
948373245 2:237504002-237504024 CTGGTTTTGAAGATGGAGAAAGG + Intronic
949048915 2:241886591-241886613 CTTGTTTTTCAGATGGAAAAGGG + Intergenic
1168840321 20:905901-905923 ACCATTTTACAGATGAGGAAAGG + Intronic
1168891259 20:1296530-1296552 CTCATTTTAAAGATGGGAATGGG - Intronic
1169248658 20:4044007-4044029 CGCATTTTAGAGATGAGGAAGGG - Intergenic
1170073992 20:12399099-12399121 CCCATTTGACAGATGAAGAAAGG - Intergenic
1170153501 20:13249273-13249295 CCCATTTCACAGATGGAACAGGG + Intronic
1170238813 20:14139331-14139353 CTCCTTTTATAGATGAAGAAAGG + Intronic
1170238973 20:14141401-14141423 CTCCTTTTATAGATGAAGAAAGG - Intronic
1171149432 20:22814227-22814249 CTCATTTTACAGGTGAGGACAGG + Intergenic
1171234193 20:23510933-23510955 CTAATCCTACAGATGGAGAAGGG + Intergenic
1171378346 20:24711477-24711499 CTCATTTTAAAAATGGGCAAAGG - Intergenic
1171988627 20:31678398-31678420 TTCATTTGACAGTTGGGGAAAGG - Intronic
1172356298 20:34282588-34282610 CTCATTTTATAAAAGGAGGATGG - Intronic
1172804194 20:37599424-37599446 CCCATTTTACAAATGGAAAAGGG - Intergenic
1172807369 20:37622052-37622074 CCCATTTTACAGATGAAAAGAGG - Intergenic
1172820886 20:37733153-37733175 CCCATTTTACAGATGAAGATGGG - Intronic
1172882133 20:38208960-38208982 TCCATTTCACAGATGGGGAAAGG + Intergenic
1172938525 20:38638510-38638532 CCCAATTTACAGATGTTGAAAGG - Intronic
1173143475 20:40505067-40505089 CTAAATTTACAGATGCAGATAGG - Intergenic
1173467175 20:43292498-43292520 ACCATTTTCCAGATGGAGAGAGG + Intergenic
1173498294 20:43534576-43534598 CCCATTTTACAGATGATGTAAGG - Intronic
1173858910 20:46269309-46269331 CTCATTTTCCTGATGGAGAGAGG + Intronic
1174300711 20:49580211-49580233 CGCATTTTACAGATGAGGAATGG + Intergenic
1174465674 20:50715369-50715391 CTGATTTTAAAGATGGAGGTGGG + Intergenic
1174502517 20:50996103-50996125 CCCATTTTATAGCCGGAGAAAGG - Intergenic
1174511004 20:51052500-51052522 CCCTTTTTACAGATGAGGAAAGG + Intergenic
1175585527 20:60136441-60136463 CCCATTTTGCAGATGAAGAATGG + Intergenic
1175740662 20:61417701-61417723 CTCATTTTACGGCTGGAGACAGG + Intronic
1175848601 20:62073756-62073778 CTCACTTTACAGCTAAAGAAGGG + Intergenic
1175957412 20:62618436-62618458 CCCATTTTACAGATGGCATAGGG + Intergenic
1175989135 20:62778859-62778881 CTCCATTTACAGATGGGGAGAGG + Intergenic
1176127982 20:63484425-63484447 CCCCTTTCACCGATGGAGAAGGG + Intergenic
1176697705 21:10000699-10000721 CTCATTTCAAAAATGGAGGAAGG - Intergenic
1177068794 21:16474962-16474984 CTTATTTTACAGATGCATAAAGG - Intergenic
1177918097 21:27116042-27116064 CTCATTTTATAGAAGAGGAAAGG - Intergenic
1177955274 21:27590625-27590647 CTCATTTTCCAGCTGTAAAATGG + Intergenic
1178038383 21:28610588-28610610 TTCATTTAAAAGATGCAGAATGG + Intergenic
1178475338 21:32932860-32932882 ATCCTTTTTCAGAAGGAGAAAGG - Intergenic
1178585413 21:33867043-33867065 CACACTTTCCAGATGGAGAATGG - Intronic
1178896723 21:36564865-36564887 CTCACTTTGAAGGTGGAGAAAGG + Intronic
1180721738 22:17914425-17914447 TCCATTTTGCAGATGGGGAAAGG + Intronic
1181468823 22:23125673-23125695 CCCATTTTACAGATGAGGAAAGG + Intronic
1181508239 22:23376148-23376170 TTCATTTCACAGCTGGAAAATGG - Intergenic
1181764316 22:25080238-25080260 CCCATTGTACAGCTGGGGAAGGG - Intronic
1181979487 22:26756030-26756052 CTTATTTTACAGAAGCAGAGAGG + Intergenic
1182088129 22:27575429-27575451 CTCATTTTCCAGACAGACAAAGG - Intergenic
1182481380 22:30611196-30611218 TTCATTCTATAGATGGACAAAGG - Intronic
1182722625 22:32415583-32415605 CCCATTTTACAGATGAGGAAAGG - Intronic
1182869955 22:33637254-33637276 CTCATTTTAAAAATGATGAAAGG - Intronic
1182882266 22:33743730-33743752 CCCATTTTACAGATGATGAAAGG + Intronic
1183108558 22:35631483-35631505 GCTATTTGACAGATGGAGAAAGG - Intronic
1183198244 22:36368146-36368168 CCCATTGTACAGATGAAGAAAGG - Intronic
1183340561 22:37278387-37278409 CTCATCTTACAGATGGGAAACGG - Intergenic
1183417216 22:37689286-37689308 CCCAGTTCACTGATGGAGAAAGG - Intronic
1183528556 22:38339042-38339064 TTCATGTTACAGATGAGGAAAGG + Intronic
1183602995 22:38850839-38850861 CCCATTTTACAGATGAGGAAAGG - Intergenic
1183736582 22:39648050-39648072 CTCACTTTATAGAGGGAGACAGG - Intronic
1183827963 22:40403455-40403477 CTCATTTTAGTGAGGGAGACAGG + Intronic
1183854261 22:40619414-40619436 CTCGTTTTACAGTAGCAGAAAGG + Intronic
1184301609 22:43564046-43564068 CCCATTTCTCAGATGGAGGACGG - Intronic
1184388308 22:44188637-44188659 CCCATTTCACAGATGAGGAAAGG + Intronic
1184404798 22:44293695-44293717 CCCATTTTACAGATGAGGAAGGG - Intronic
1184526954 22:45029807-45029829 CTCAGTTTATAGATGAAGAAAGG + Intergenic
1184696112 22:46139967-46139989 CTCATTTTACAGCTGGGAATGGG + Intergenic
1184813649 22:46854261-46854283 CCCATTTTACAAATGAGGAAAGG - Intronic
1203293112 22_KI270736v1_random:14620-14642 CCCATTTTACAGATGAGGATAGG - Intergenic
949187099 3:1205119-1205141 CTGATTTTAAAGATAGAGAAAGG + Intronic
949294293 3:2502714-2502736 TTCATTTTACAGAGGAAGAAAGG + Intronic
949562394 3:5214669-5214691 TCCATTTTACAGCTGAAGAAAGG + Intronic
949718284 3:6959186-6959208 TACATTTTACAGAGGAAGAAAGG + Intronic
949776833 3:7642868-7642890 CTCATTTTATAGATCATGAATGG + Intronic
950018133 3:9768502-9768524 CCCATTTATCAGATGAAGAATGG + Intronic
950050812 3:9987422-9987444 CTCATTTTAACGACGCAGAAAGG - Intronic
950090483 3:10291069-10291091 CTCATTTTACCCAGGGAGAAAGG - Exonic
950165404 3:10793523-10793545 CCCATTTTACAGATGGGAAATGG + Intergenic
950289056 3:11768938-11768960 GACATTTGACAGATGGTGAAAGG + Intergenic
950708931 3:14801658-14801680 CTCATCTTACAGATGAGGAGAGG + Intergenic
951263575 3:20540647-20540669 CTCATTTGAAAGATGCTGAATGG - Intergenic
951598027 3:24339383-24339405 CCCGTTTTCCAGATGAAGAAAGG + Intronic
951901083 3:27658271-27658293 CTCCTTTTCCAGATGAGGAAAGG + Intergenic
952374972 3:32759405-32759427 CTCATTTTAAACATTGATAATGG - Intronic
952466896 3:33598420-33598442 GCCATTTCACAGATGTAGAAGGG - Intronic
952627606 3:35425837-35425859 CTCATTTTAATGATGGGGAAGGG - Intergenic
952675511 3:36025739-36025761 GTCATTTCACAGAAGGAGAAAGG - Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953415188 3:42711727-42711749 CTCATTTTACGGATGGGCCAGGG + Intronic
953426858 3:42802699-42802721 CTTATTTTACAGGTGGGGAAAGG + Intronic
953695388 3:45154287-45154309 CTCATTTTAAAGAGGGGGTAGGG + Intergenic
954034089 3:47841173-47841195 CTCAAGGTACAGATGGAGGATGG + Exonic
954270886 3:49507828-49507850 ATTATTTTACAGAGGCAGAAAGG - Intronic
954957084 3:54530696-54530718 CTCATTTTATAAATGAAGAAGGG + Intronic
955079396 3:55644181-55644203 CTCATTTTACAGATGGTAAAAGG - Intronic
955121191 3:56060352-56060374 CCCATTTTACAGATGGGAAAAGG - Intronic
955375698 3:58394802-58394824 CTCCTTCTTCAGATGGAGGAAGG - Intronic
955655055 3:61236603-61236625 CTCACTTTACAGATGTGGAAAGG + Intronic
955758346 3:62250221-62250243 CCCATTTTACAGATGAGGAAAGG + Intronic
955811091 3:62790650-62790672 TTCATTTTATAGATGGGTAAAGG - Intronic
955976914 3:64488756-64488778 CTGCTTTTACAGAGGAAGAAAGG - Intergenic
956702710 3:71972798-71972820 CTCATTTGACAGTTGACGAAAGG + Intergenic
956741723 3:72280737-72280759 CCCATTTTACAGATGAAGAGAGG + Intergenic
956760349 3:72437648-72437670 CTAAATTGACAGAGGGAGAAAGG + Intronic
956924525 3:73969495-73969517 CTCAGTTTTCAGCTGGAAAATGG - Intergenic
957078164 3:75617842-75617864 CTCAGTCTACAGATGCGGAAGGG + Intergenic
957665539 3:83219865-83219887 CTCATTTTAAAAATGGGGACCGG - Intergenic
958139773 3:89547438-89547460 TTCATTTTCCAGATGAGGAATGG - Intergenic
958574364 3:95928623-95928645 CTAATTTTTCAGTTAGAGAAAGG + Intergenic
958596455 3:96231617-96231639 CTAGATTTAAAGATGGAGAATGG - Intergenic
958692744 3:97488932-97488954 ATCATAATATAGATGGAGAATGG - Intronic
958787788 3:98617078-98617100 CTCACTGTGAAGATGGAGAAAGG - Intergenic
958816457 3:98921688-98921710 CTTATTTCACAGATGAGGAATGG + Intergenic
958888211 3:99752869-99752891 CTCAGTTTAGAGGGGGAGAAGGG + Intronic
959014897 3:101122681-101122703 CTCATGGTATAGTTGGAGAAGGG + Intergenic
959054783 3:101556658-101556680 CTCAGTTTACAGAAGGGGAGTGG - Intergenic
959148540 3:102579841-102579863 CTCATTTTATAGATAAAAAAGGG - Intergenic
959219165 3:103493846-103493868 ACCCTTTTACAGATGGAGAGTGG - Intergenic
959867016 3:111282521-111282543 GTCATTTTTCAGAGGCAGAATGG + Intergenic
961383876 3:126513552-126513574 CCCACTTTACAGATGGGGAAAGG - Intronic
961754348 3:129119181-129119203 GGCACTTTACAGATGGAGGAGGG + Intronic
962127807 3:132640696-132640718 CCCATTTTGCAGATGAAGAAAGG - Intronic
962897512 3:139729643-139729665 ATCATCTTACAGATGGGGAGTGG + Intergenic
963013117 3:140794074-140794096 CAAATTATAAAGATGGAGAACGG + Intergenic
963095329 3:141532553-141532575 CTCATTTTACAGATGAACTTAGG - Intronic
963396946 3:144747110-144747132 CTTATTGTACAAATGGACAATGG + Intergenic
963666677 3:148197050-148197072 CCCATTTTACGAATGGGGAAAGG - Intergenic
963721283 3:148865080-148865102 CCCATTTTACAGATACAGGATGG - Intergenic
964303989 3:155321117-155321139 CCCATTTTACAGATAAGGAAGGG + Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964433859 3:156632341-156632363 CCCATTTTACAGAGGAAGAAAGG - Intergenic
965221003 3:165925348-165925370 CTGATTTTGAAGATGGGGAAAGG + Intergenic
965241392 3:166203663-166203685 CTGATGTTACAGATGTAAAAGGG + Intergenic
965522880 3:169685935-169685957 CTCATTTTACTGATTAGGAAAGG + Intergenic
965742701 3:171892595-171892617 CTGAATTTCCAGATGGAGAAAGG - Intronic
965990353 3:174810703-174810725 CTCATTTTCCGGGTGGAGATTGG + Intronic
966684079 3:182675132-182675154 CTCATTTTGCAGACGAAGAGAGG - Intergenic
966723935 3:183091664-183091686 ATAATTTTACAGATGAAGCAAGG + Intronic
966812317 3:183858003-183858025 CTCATTTCTCAGATGGGGCAAGG - Intronic
966953366 3:184846029-184846051 TACATTTTACAGATGAAGATAGG + Intronic
967024441 3:185552065-185552087 CTCATTTCACAGAACTAGAAAGG + Intronic
967271030 3:187732929-187732951 TTCATTTTATAGATGGTAAAAGG - Intronic
967616029 3:191567756-191567778 TTCATTTTAAAGATGAAGAAAGG - Intergenic
968190376 3:196662900-196662922 GTCATTGAACAGAGGGAGAAGGG - Intronic
968329840 3:197858120-197858142 CTCATTTGCCACATGGAGAGTGG - Intronic
969170494 4:5358783-5358805 CTCACTTTCAAGATGGGGAAAGG - Intronic
970255395 4:14163912-14163934 CACATTTTACAGATACAGAGAGG - Intergenic
970341516 4:15112268-15112290 TTGATTTTACAGATGAAGAAAGG + Intergenic
970504373 4:16712224-16712246 CTCAATTTACAAATGGGCAAAGG + Intronic
970743224 4:19263007-19263029 CTACTTTTAAAAATGGAGAAAGG - Intergenic
970795972 4:19914053-19914075 CTCATTTTGTAAATGGAGAAGGG - Intergenic
970846390 4:20543339-20543361 CTCATGCTACAGTTGCAGAATGG + Intronic
970910187 4:21266052-21266074 CCCATTTAACAGATGAAAAATGG + Intronic
971307816 4:25498834-25498856 CCTATTTTACAGATGAGGAATGG - Intergenic
971669273 4:29534937-29534959 TTTATTTTACAGATGAGGAAAGG + Intergenic
971842700 4:31874662-31874684 CTGATTTTGAAGATGGAAAAAGG - Intergenic
972280007 4:37592721-37592743 CTCACTTTACAGATGGGTAAAGG - Intronic
972401310 4:38706327-38706349 TTCTTTTTACAGATGGAAATTGG + Intergenic
972707962 4:41564186-41564208 CCCATTTTACAGATGAGGAAAGG + Intronic
972721079 4:41699341-41699363 CACATTTTGCAGTTGGAGAATGG - Exonic
972777155 4:42252006-42252028 CTTATTATACAGATGCAGGACGG + Intergenic
973819265 4:54648444-54648466 CCCATTTTACAGATAAGGAAAGG - Intergenic
973974673 4:56250720-56250742 CACGTTTTACAGATAGAAAATGG - Intronic
974160642 4:58133658-58133680 CTTATTTTGAAGATGGAGAAAGG + Intergenic
974366688 4:60959165-60959187 CTCATTTTACTCATGGGAAATGG - Intergenic
974803397 4:66848432-66848454 CTCACTTTATAGATAAAGAAAGG + Intergenic
974827937 4:67153047-67153069 CTCATCTTGCAGATGGACAGAGG - Intergenic
975175045 4:71278767-71278789 CTCATTTTTTAAATGGACAAAGG - Intronic
975189305 4:71441057-71441079 CTGGTTTTACAGATGAAAAAAGG + Intronic
975283263 4:72587698-72587720 ATTATTTTACAGATGAGGAAAGG + Intergenic
975655853 4:76640691-76640713 GCCGTTCTACAGATGGAGAATGG + Intronic
976276311 4:83282732-83282754 TTCATTTTACAGATGAAAAACGG + Intronic
976464965 4:85356686-85356708 CTCAATTTAAAAATGCAGAATGG - Intergenic
976652889 4:87454974-87454996 CTGTTATTACAGAAGGAGAAAGG + Intronic
976712657 4:88088818-88088840 CTCATTTTACAGATGCATAAAGG + Intergenic
977284235 4:95082441-95082463 CTCATTTTACAAATGATGAGGGG - Intronic
977889793 4:102296581-102296603 CTCATTTAACAGATGAGCAAAGG + Intronic
977922730 4:102663281-102663303 CTAATTTTATAGATGGGAAAAGG + Intronic
978130404 4:105189160-105189182 CCCATTTTACAGAGTAAGAAGGG - Intronic
978397590 4:108298268-108298290 TTAATTTTACAGCTGGAAAATGG + Intergenic
979300735 4:119084069-119084091 CTCATTTTACAGAAAGGAAATGG + Intergenic
979745747 4:124211003-124211025 CACATTGAAGAGATGGAGAAAGG + Intergenic
980155664 4:129101840-129101862 CCCATTTTTCAGTTGGAGAGAGG + Intronic
980370253 4:131860574-131860596 CTCATTTTAGAAATGGAGGAAGG - Intergenic
980786085 4:137557184-137557206 CTCTTTCTACAAATGCAGAATGG - Intergenic
980976953 4:139620327-139620349 CCCTCTTTACAGATGAAGAAAGG + Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
982266924 4:153546233-153546255 ATTATCTTACAGATGGAGAAGGG + Intronic
982289981 4:153770306-153770328 CTCAATTTAAAAATGGACAAAGG - Intergenic
982479286 4:155889602-155889624 CTCACTTCACAGATGGGAAACGG - Intronic
982771339 4:159400188-159400210 CCCATTTGACAGATGGGAAATGG + Intergenic
983302274 4:165942033-165942055 CCCATTTTACAGATGGAAATGGG + Intronic
983570424 4:169202011-169202033 TTCATTTTGCAGATGGGTAAAGG - Intronic
984735262 4:183102204-183102226 CTCATTTTAGAGCTGAAAAATGG - Intronic
984783689 4:183549189-183549211 CTCATTTTAAAGATAGGCAAAGG - Intergenic
985819869 5:2152331-2152353 CTCATTGCACAGATGGAAGATGG + Intergenic
985819872 5:2152366-2152388 CTCATTGCACAGATGGAAGATGG + Intergenic
985819875 5:2152401-2152423 CTCATTGCACAGATGGAAGATGG + Intergenic
985915684 5:2917398-2917420 CCCACTTCACAGATGGAGACTGG - Intergenic
986384757 5:7221484-7221506 CTCATTTTAGAAAAGAAGAAAGG - Intergenic
986645850 5:9915313-9915335 TTCAGTTTACAGAAGGAAAATGG + Intergenic
986712929 5:10500892-10500914 CCCATTTTACAGATGAAAAGTGG - Intergenic
986834321 5:11617904-11617926 CACATTTTATGGATGGAAAAGGG + Intronic
987959339 5:24785006-24785028 TACACTTTGCAGATGGAGAAAGG - Intergenic
988027645 5:25719362-25719384 TTCATTTAACAAATAGAGAAGGG - Intergenic
988123607 5:26999591-26999613 CTCATTTGACAAAGGGACAAAGG + Intronic
988324132 5:29739648-29739670 CCCAATTTAAAGATGCAGAATGG + Intergenic
988496209 5:31748381-31748403 GCCACTTTACAGATGAAGAATGG - Intronic
988815510 5:34830483-34830505 CTCATCTTCCAGCTGGATAAAGG + Intronic
989101618 5:37828685-37828707 CCCATTTTACAGGTGAAGAAAGG - Intronic
989217922 5:38924191-38924213 TGCCTTTTACAGATGAAGAATGG - Intronic
989422567 5:41256820-41256842 CACATTTTACAAATGGGTAAAGG + Intronic
990278321 5:54223479-54223501 GTCATTTTAGAGATAGAAAAGGG + Intronic
990539126 5:56754803-56754825 CCTATTTTACAGATGAGGAAAGG + Intergenic
990649838 5:57885884-57885906 CTCTTTTTAAGGAGGGAGAAGGG - Intergenic
991318115 5:65335224-65335246 CTCATTTTACATTTGAGGAAAGG + Intronic
992008298 5:72501058-72501080 CTCATCTTAGAGCTGAAGAAAGG - Intronic
992187757 5:74260257-74260279 CTCATTTTAGAAATGTGGAAAGG + Intergenic
992370438 5:76138168-76138190 GTCATTTTAAAGATGAAGATAGG + Intronic
992377490 5:76202615-76202637 CTCATTTTACATATTGGGGAAGG - Intronic
992508387 5:77409868-77409890 CTCAAGTTCCAGGTGGAGAATGG - Intronic
992575270 5:78102487-78102509 CTCATTTGAGAAATGGAGAGAGG - Intronic
992579645 5:78158577-78158599 ATTATTTTAAAGATGAAGAAAGG + Intronic
993033258 5:82728862-82728884 CACAGTTTACAGAAGGAAAAGGG - Intergenic
993667069 5:90712291-90712313 TTCATTTTGCTGATGGAGAAAGG + Exonic
994491209 5:100445740-100445762 TACATTTTCCAGATGGCGAAAGG + Intergenic
995924338 5:117352450-117352472 CACATTTTACAGGTGGGTAAGGG + Intergenic
996016391 5:118538611-118538633 CTCACTTTGCAGATGGAAGACGG - Intergenic
996398085 5:123033137-123033159 TTTATTTTACAGATGAAGAAAGG - Intronic
996612381 5:125397828-125397850 ATCATTTTATAGTTGTAGAAGGG - Intergenic
996815257 5:127566956-127566978 CTAATTTTACAGATGAAAATGGG - Intergenic
997119611 5:131160674-131160696 TCCATTGTACAGATGGACAATGG + Intronic
997360924 5:133294366-133294388 CCCATTTTACAGAAGAGGAACGG - Intronic
997579952 5:135010914-135010936 CTCATGTGACAGATGGGAAAGGG - Intronic
998203248 5:140141992-140142014 CTCTTTTTACATATAGAAAAAGG + Intergenic
998692976 5:144607738-144607760 CTCATTTTACAGATGAAAGGAGG - Intergenic
998940315 5:147274765-147274787 CTCATTTTATAGATGCAGAAAGG + Intronic
999182472 5:149679855-149679877 CCCATTTTACTGATGAGGAAAGG + Intergenic
999380296 5:151116853-151116875 CTCATGTTACAGTGGGAAAATGG - Intronic
1000565725 5:162845124-162845146 GCCATTTTATAGATGGAAAATGG + Intergenic
1001070428 5:168580270-168580292 CTCATTTTGAAGATGGGGCACGG + Intergenic
1001308023 5:170589977-170589999 CCCATTTTGCAGAGGGGGAAAGG - Intronic
1001513994 5:172342332-172342354 CTCATTTTACGCATGCAGAACGG + Intronic
1001547204 5:172577882-172577904 CTCACTTTACAGATGGGAAACGG + Intergenic
1001841047 5:174877111-174877133 CCCATCCTACAGATGGGGAAAGG + Intergenic
1002347835 5:178560375-178560397 CCCATTTCAAAGATGGAGAAAGG - Intronic
1002845236 6:939457-939479 TTCATTTGTAAGATGGAGAAGGG + Intergenic
1002883243 6:1271488-1271510 CCCTTTTTACAGATGATGAATGG + Intergenic
1003010769 6:2425347-2425369 CTGATTTTAAAAATGGACAAAGG - Intergenic
1003840721 6:10116515-10116537 CTCATTTTACTTATGGAGTTTGG - Intronic
1004201995 6:13557038-13557060 CACATTTTACAGATGAGAAATGG + Intergenic
1004210448 6:13636284-13636306 ACCATTTTACAGATGTAGAGCGG - Intronic
1004285852 6:14320024-14320046 ATCTTTTTACAAATGGAGCAAGG - Intergenic
1004314665 6:14575402-14575424 CACATTTCACAGATGAAGAAAGG + Intergenic
1004398908 6:15270498-15270520 CTCATTTTACAGGCATAGAATGG + Intronic
1004535669 6:16498823-16498845 CCCAGTTTAAAGATGGACAAAGG - Intronic
1004569871 6:16834821-16834843 CTCATTTTGCAGATGATGGAAGG + Intergenic
1004676337 6:17846317-17846339 CTCTTTTTAAAGATGAGGAAAGG - Intronic
1004740844 6:18459217-18459239 TTCATTAGACAAATGGAGAAGGG - Intronic
1004741154 6:18462573-18462595 TTCATTAGACAAATGGAGAAAGG - Intronic
1006548261 6:34797817-34797839 CATATTTTATAGATGAAGAAAGG + Intronic
1006725871 6:36198323-36198345 CTCATTTTACTGATGGAGTATGG + Intronic
1007095493 6:39210303-39210325 CTAATTTTACACATGGGGAGAGG - Intronic
1007097972 6:39226034-39226056 CTCATTTTGCAGATGAGGAAAGG + Intronic
1007374940 6:41450164-41450186 CCCATTTTACAGATGATAAAAGG - Intergenic
1007379238 6:41476400-41476422 CCCATTTTTCAGATGAAGAAAGG + Intergenic
1007418367 6:41705281-41705303 CTCATTGTTCAGATGGAGCTGGG - Intronic
1007519911 6:42443984-42444006 CTCTTTTTACAGATGTAGAGAGG + Intronic
1007652789 6:43433568-43433590 CTCACTTTACAGATGAGGAAGGG - Intronic
1007861095 6:44909677-44909699 CTCACATTACAGATGGAGAGAGG + Intronic
1008628811 6:53344598-53344620 CCCATTTTACAGGTGGAAAAAGG - Intronic
1009157940 6:60246490-60246512 TACATTTTACATTTGGAGAATGG + Intergenic
1009572424 6:65404162-65404184 CTGGTTTTAAAGATGGAGGAAGG - Intronic
1010052572 6:71524956-71524978 CTCATGTTAGAGATGGCGAAAGG + Intergenic
1010106388 6:72174117-72174139 CTCAAATCACAGATGGAGGAGGG - Intronic
1010873289 6:81068774-81068796 CTCTCTTTACAGCTTGAGAATGG - Intergenic
1010927291 6:81757872-81757894 CTAAGTTTAGAGATGAAGAAAGG + Intergenic
1011048268 6:83111691-83111713 CTAATTTTTAAGATGGACAAAGG - Intronic
1011831780 6:91382596-91382618 CTCATTTTTCAGATAAAGAGTGG + Intergenic
1012316326 6:97785488-97785510 CTAATTTTACAGAGGGTAAAAGG + Intergenic
1012510443 6:99994924-99994946 CTCATCTTATAGATGAAGGAAGG - Intergenic
1013563869 6:111335600-111335622 CTTTTTTAACAGATGGAAAATGG - Exonic
1013859883 6:114623100-114623122 CTAATTTTACAGATGAGGATGGG + Intergenic
1014037580 6:116785237-116785259 TTCATTTTACAGGTGGGAAAAGG + Intergenic
1014155327 6:118102984-118103006 CTAATTTTACAGATGGGTAAAGG - Intronic
1014293359 6:119587543-119587565 CTCATTTTATAGTTGAGGAATGG + Intergenic
1014318099 6:119892107-119892129 CTCGTTTTAAAGATTAAGAATGG - Intergenic
1014512571 6:122342212-122342234 CTGGCTTCACAGATGGAGAATGG + Intergenic
1015025522 6:128527750-128527772 CTTATTTGAAAAATGGAGAAGGG + Intergenic
1015212763 6:130716963-130716985 CTCTTTTTAAAGGGGGAGAAAGG - Intergenic
1016402584 6:143696528-143696550 CCCATTCTACAGATGAGGAAGGG + Intronic
1016540742 6:145160951-145160973 TTCATTTTACAGCAGCAGAAAGG + Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017632779 6:156413700-156413722 CTCATTTTGAAGATGGAAGACGG + Intergenic
1017649109 6:156564877-156564899 CTCATTTTACAGAAGAAACAAGG + Intergenic
1019501417 7:1366706-1366728 CCCATTCTACAGAGGAAGAACGG + Intergenic
1019778529 7:2926354-2926376 CTCATTTTATAGATAAAGACAGG - Intronic
1019981837 7:4627388-4627410 CTCATTTTCCTTCTGGAGAAGGG + Intergenic
1020529201 7:9308674-9308696 ATTATTTTACACATGGAGAAAGG - Intergenic
1020741435 7:12024092-12024114 ATCATTTTATAGATGGTGAAAGG - Intergenic
1020744467 7:12064574-12064596 CTCGTTTTAAAGATGCAGAAAGG + Intergenic
1021564476 7:22003512-22003534 CCCATTTTAGAGATGGCAAATGG + Intergenic
1021585035 7:22198829-22198851 CCCATTTTACAAATGGAGACAGG + Intronic
1021695740 7:23274366-23274388 GTCATTTTAGAGATGGGGAGAGG + Exonic
1022149741 7:27589551-27589573 CCTATTTTACAGATGTAGAAAGG + Intronic
1022234904 7:28451999-28452021 CTCCCTTTACCGAGGGAGAAAGG + Intronic
1022939269 7:35216431-35216453 CTTATTTTACAGATGAGAAAAGG - Intronic
1022979982 7:35595316-35595338 CTCATTTTCCGGATGAGGAAAGG - Intergenic
1023060808 7:36323998-36324020 CTCATGGGACATATGGAGAAAGG - Intergenic
1023153065 7:37220805-37220827 CTTCTTTCACAGATGGGGAAAGG + Intronic
1023392319 7:39722089-39722111 CTCTTTCTACATATGGAGAGGGG + Intergenic
1023448134 7:40253151-40253173 CCCATTTCACAGATGAAAAAAGG - Intronic
1023851959 7:44155432-44155454 CCCATCTTGCAGATGAAGAAAGG + Intronic
1024397663 7:48887915-48887937 CCCATCTTACAGCTGGTGAAAGG + Intergenic
1024479436 7:49848608-49848630 ATGATTTTACAAGTGGAGAAAGG - Intronic
1024598299 7:50958385-50958407 CCCATTTTACAGATGAGGAGAGG - Intergenic
1024676614 7:51643527-51643549 CTCAATTTACTGATGGGGAGGGG - Intergenic
1026182840 7:68057164-68057186 TTCATTTTACAAATGAAGAAGGG - Intergenic
1026374006 7:69731898-69731920 CCCATTTTACAGATGAGGAAAGG - Intronic
1026463577 7:70634994-70635016 CCCTCTTTACAGATGGTGAAGGG - Intronic
1027724053 7:81780867-81780889 CTGATTTTGAAGATGGAGAAAGG + Intergenic
1027776887 7:82476407-82476429 CTACTTTTACATATGAAGAAAGG + Intergenic
1027850611 7:83446804-83446826 CTCATTTAACAAATGAAAAAAGG - Intronic
1028003080 7:85526046-85526068 TCAATTTTACAGATTGAGAAAGG + Intergenic
1028178831 7:87691895-87691917 CTCATTTTACAGATGAGAAAAGG - Intronic
1028931695 7:96420146-96420168 CTCATTTTATATATGAAAAATGG - Intergenic
1028944821 7:96565674-96565696 CTAATTTTACTGATGAAAAAAGG + Intronic
1029040869 7:97573117-97573139 CTTATTCTACAGTTAGAGAAAGG - Intergenic
1030254638 7:107495058-107495080 CTCATTTTACAGATCTTGTAAGG - Intronic
1030608933 7:111668134-111668156 CAGATTTTGAAGATGGAGAAAGG + Intergenic
1030864534 7:114683461-114683483 CCCATTTTACAGATGAGTAAAGG - Intronic
1030891445 7:115003903-115003925 CTCATTTTACAGATGAAAAACGG - Intronic
1031062714 7:117070308-117070330 CTCCTTTTACAGATGAGAAATGG - Intronic
1031207375 7:118777736-118777758 CTCACTGTACAGACGAAGAAAGG + Intergenic
1031226014 7:119038842-119038864 ATCATTTTACAGATGAAGAGAGG - Intergenic
1031910412 7:127511160-127511182 CTGGCTTTACACATGGAGAAAGG + Intergenic
1031976477 7:128096967-128096989 CTCATTTTATAGGATGAGAAGGG + Intergenic
1032357411 7:131223611-131223633 AGCATTTTAGAGATGGAGAATGG - Intronic
1032650182 7:133869404-133869426 CTCATTTTACAGATGAAGACAGG - Intronic
1033685460 7:143636260-143636282 CTCACTTTAAAGATGGAGTTTGG - Intronic
1033688630 7:143715478-143715500 CTCACTTTAAAGATGGAGTTTGG - Intronic
1033699154 7:143821360-143821382 CTCACTTTAAAGATGGAGTTTGG + Intergenic
1034221647 7:149451067-149451089 CTCATGTCACAGATGGAGCGCGG - Exonic
1034344959 7:150380178-150380200 TTCATTTTACAGATGAACATGGG - Intronic
1034762300 7:153684366-153684388 CTTATTTTACAGATGAAGGCAGG + Intergenic
1034880461 7:154758829-154758851 CTCATTTTACAGTAGAAGAAAGG + Intronic
1035936513 8:3847233-3847255 GACATTTTGCAGATGTAGAAAGG + Intronic
1036286578 8:7448494-7448516 GTCACTTTACAGATGGGGACAGG + Intronic
1036334899 8:7863030-7863052 GTCACTTTACAGATGGGGACAGG - Intronic
1036608733 8:10331361-10331383 CCCATTTTACAAAAGAAGAATGG - Intronic
1036969321 8:13336681-13336703 CTCATTTTATAGATAAAGAAGGG - Intronic
1037089255 8:14893229-14893251 CTCATTTTAAAGATGGAGGAAGG + Intronic
1037323441 8:17665465-17665487 CTCATTTTACCAAAGAAGAATGG + Intronic
1037613502 8:20496091-20496113 CTCATTTTACAGAAAAAGAAAGG - Intergenic
1037878588 8:22561616-22561638 CTCATCTTATAGATGAGGAAAGG - Intronic
1038174261 8:25165977-25165999 CTCATTTAACAAATGGAGGCCGG + Intergenic
1038377232 8:27053589-27053611 GACATTTTAGAAATGGAGAATGG + Intergenic
1038560292 8:28571240-28571262 TTCCTTTTAAAAATGGAGAATGG - Exonic
1039232705 8:35465896-35465918 CTCATTTTGAAGGTGGAGGAAGG + Intronic
1039320940 8:36430348-36430370 TTCATTTCACAGATCAAGAATGG + Intergenic
1039351982 8:36773024-36773046 CTTATTTTCTAGCTGGAGAAGGG + Intergenic
1039460287 8:37737709-37737731 CTAATTTTACAGTTAAAGAAAGG + Intronic
1039741202 8:40384522-40384544 CTGATTTTGAAGATGGTGAATGG + Intergenic
1039890719 8:41683673-41683695 CTGATTTTACAGAAGGGGAGAGG + Intronic
1040652239 8:49462269-49462291 CTCATTTTACAGATGAAAAATGG + Intergenic
1040762109 8:50860940-50860962 CACATTTTACCCCTGGAGAATGG + Intergenic
1040810520 8:51447779-51447801 GTCTTGTTACAGATGGAAAAAGG + Intronic
1041049480 8:53919210-53919232 CCCAATTTAAAAATGGAGAAAGG - Intronic
1041116164 8:54539627-54539649 CTCTATTAACAGATGGAGGAAGG - Intergenic
1041303944 8:56440519-56440541 CCAATTTTACAAATGAAGAAAGG - Intronic
1041751454 8:61265422-61265444 CTCACTTTACAGATTAAAAATGG - Intronic
1041957362 8:63570745-63570767 CTGACTTTGAAGATGGAGAAGGG + Intergenic
1042449217 8:68924724-68924746 CTCATTTGACATTTGCAGAAAGG - Intergenic
1042693050 8:71525088-71525110 CTCATTTTAGAGATGAAGATGGG + Intronic
1042708713 8:71691050-71691072 CTGACTTTGAAGATGGAGAAAGG - Intergenic
1042765294 8:72314591-72314613 CTCATTTTACAAAAAGATAAGGG + Intergenic
1042892467 8:73627408-73627430 CACATGCTACAGATTGAGAAGGG + Intronic
1043375815 8:79648217-79648239 CTCATTTTACAGATTGACAAAGG - Intronic
1043547615 8:81333001-81333023 CAAATTTTATAGATGCAGAACGG - Intergenic
1043810816 8:84737795-84737817 CTCATTTGGCAGAAGGAGGAAGG - Intronic
1044206503 8:89497067-89497089 ATTTTTTTACAGATGGGGAAAGG - Intergenic
1044246982 8:89959830-89959852 CTCATTTTATAGATGAGGAAAGG - Intronic
1044378771 8:91507010-91507032 CTCTTTTGAAAGATGGAGGAGGG - Intergenic
1044865423 8:96566029-96566051 AACATTTTACAGATGGGAAAAGG - Intronic
1044897891 8:96911978-96912000 ATCACTTTACAGATGGGGAAAGG - Intronic
1045190909 8:99882700-99882722 CTGATTTTACAGATCTAAAAAGG + Intronic
1045225269 8:100237983-100238005 CCCATTTTAAAAATGAAGAATGG - Intronic
1045252433 8:100493096-100493118 TCCATTTTACAGATGAGGAAAGG + Intergenic
1045665877 8:104483772-104483794 CCCATTTTACAGATGAAGAATGG + Intergenic
1045769643 8:105720902-105720924 CTACTTTTACAGATGCAGCAAGG - Intronic
1046518078 8:115289026-115289048 CCCATTTTACATAGGGAGGAGGG + Intergenic
1046783169 8:118237514-118237536 CTCTTCTTACAGCTGGGGAAAGG - Intronic
1047024965 8:120814287-120814309 CCCATTTCACAGGTGAAGAAGGG + Intergenic
1047194367 8:122708098-122708120 GTCGTTCTCCAGATGGAGAAGGG + Intergenic
1047473791 8:125205449-125205471 AACATTTTACTGATGGATAAGGG - Intronic
1047487646 8:125346331-125346353 CTCAAGATAAAGATGGAGAATGG + Intronic
1047505828 8:125479250-125479272 CTCATCTAACAGCTGGAGAGAGG - Intergenic
1047769964 8:128022732-128022754 ATCATTTTATAGATGAAGAAGGG - Intergenic
1047806740 8:128368953-128368975 CTCATTTTGCAGATGAAAAAAGG - Intergenic
1048370922 8:133775488-133775510 CTCATTTTATAGATGAGGAAAGG - Intergenic
1048496563 8:134940623-134940645 CTCCTTGGAGAGATGGAGAAAGG + Intergenic
1049398345 8:142412339-142412361 CTCATTTTCCAGATGGGAAAAGG - Intergenic
1050127893 9:2378442-2378464 CTGGCTTTAAAGATGGAGAAAGG + Intergenic
1050452061 9:5792384-5792406 CTAGTTTTAAAGATGGAAAAGGG + Intronic
1051046941 9:12886962-12886984 CTGTTTTGACATATGGAGAAAGG - Intergenic
1051222968 9:14869593-14869615 CTCATTTAACAAATGAGGAAAGG - Intronic
1051994226 9:23194905-23194927 CCTATATTACAGATGAAGAAAGG - Intergenic
1052043307 9:23766252-23766274 CTCTTGTTACAGTGGGAGAACGG - Intronic
1052338108 9:27339617-27339639 CTTATTTTACAGAGGGGTAATGG + Intronic
1052500094 9:29278153-29278175 CCCATTTTAAAAATGGACAAAGG - Intergenic
1052959898 9:34286473-34286495 CACATTTTACAGATGGGAAGTGG + Intronic
1053199170 9:36141198-36141220 CTCATTTTATGTATGGGGAAAGG + Intronic
1053323619 9:37121393-37121415 CTCGTTTTATAGTTGGAGAAAGG - Intronic
1053418920 9:37964567-37964589 CTCATTATGCAGATGGGAAATGG + Intronic
1053634831 9:39987063-39987085 CTCATTTTAAAAATGGAGGAAGG - Intergenic
1053771095 9:41477271-41477293 CTCATTTTAAAAATGGAGGAAGG + Intergenic
1054209056 9:62263634-62263656 CTCATTTTAAAAATGGAGGAAGG + Intergenic
1054315756 9:63584505-63584527 CTCATTTTAAAAATGGAGGAAGG - Intergenic
1054549829 9:66389076-66389098 CTCATTTTAAAAATGGAGGAAGG + Intergenic
1054877422 9:70111452-70111474 CTCATTTTACAGATGAGCAATGG - Intronic
1054928332 9:70610812-70610834 CTTACTTTACAGATGAGGAAAGG + Intronic
1054950992 9:70851725-70851747 CCCATCTTACAGATGAAGAAAGG + Intronic
1055747999 9:79471997-79472019 CTCATTCTCCTGATGGAGACAGG + Intergenic
1056899986 9:90589246-90589268 CTTATATTACAGAAGAAGAAAGG + Intergenic
1057252775 9:93517118-93517140 CCCATTTCACAGATGGACAGAGG - Intronic
1058455290 9:105132753-105132775 TTCATTTCCCAGAGGGAGAATGG - Intergenic
1058689953 9:107511496-107511518 CCTATTTTACAGATAAAGAAAGG + Intergenic
1058816126 9:108684342-108684364 CTCATTCTCCATATGGAGAAGGG - Intergenic
1059454967 9:114394676-114394698 GGCATTTAACAGATGAAGAAAGG + Intergenic
1059704150 9:116804177-116804199 CCCATTTTACAGAATGAGAATGG - Intronic
1060024039 9:120156026-120156048 CCCATTTTACAGCTGGAAAAAGG + Intergenic
1060033407 9:120234783-120234805 CTGATTTTGTAGATGGGGAATGG - Intergenic
1060153619 9:121303896-121303918 CTCATTTTACCAGGGGAGAAGGG + Intronic
1060386815 9:123238008-123238030 CTCATTTTACAGAGACAGAAAGG - Intronic
1060517120 9:124272780-124272802 TTCATTTTACAGATGAGGAAAGG + Intronic
1060717690 9:125949212-125949234 CTCATTTTATAGATAAAAAATGG - Intronic
1060731157 9:126037877-126037899 ATCATTTTACAGATGGAGTACGG - Intergenic
1060885626 9:127150110-127150132 TTCATTTTACAGAAGAGGAAAGG - Intronic
1061077203 9:128348828-128348850 ACCATTTTCCAGATGGAAAAAGG - Intronic
1061363257 9:130157024-130157046 CTCATCTTACAGATGGGAGAAGG - Intergenic
1061367923 9:130182165-130182187 CCCATTTTACAGATGAGGAAAGG + Intronic
1061403634 9:130382058-130382080 CTCATTTCACAGATGAGGCAGGG + Intronic
1061408744 9:130406783-130406805 TCCATTTGACAGATGGAGAGCGG - Intronic
1061414134 9:130436900-130436922 TCCATTTTACAGATGCAGAAAGG + Intergenic
1061648267 9:132024315-132024337 CTCCTTTTACAGATGAAGAATGG + Intronic
1061806720 9:133141046-133141068 CCCATTTGACAGATGGGGCAAGG + Intronic
1061936142 9:133858705-133858727 CTCATCTTGCAGATGTAAAAAGG + Intronic
1062019827 9:134313931-134313953 CCCATTATACAGATGAGGAAAGG + Intergenic
1062597562 9:137306091-137306113 GTCATTTCACAGATGGGGAGGGG - Intergenic
1185668011 X:1783069-1783091 CTCATTTTACAGATGAGAAATGG - Intergenic
1185839661 X:3376826-3376848 CTGGCTTTGCAGATGGAGAAAGG - Intergenic
1186105951 X:6206058-6206080 CTCATTTTACAGTTGAGGGAAGG + Intronic
1186134054 X:6500235-6500257 ATCATTTTACAGAAGGTGAAAGG + Intergenic
1186622880 X:11260113-11260135 CTAGCTTTACAGATGGAAAAAGG + Intronic
1186659807 X:11658154-11658176 CTTATTTTACAGTTGAAGAGAGG - Intronic
1186880152 X:13857008-13857030 CTGACTTTGAAGATGGAGAAAGG - Intronic
1187253614 X:17621859-17621881 CTCATTTTACGGATGAGGAAAGG - Intronic
1187614138 X:20974741-20974763 CTCATTTGACATTTGTAGAATGG - Intergenic
1187672348 X:21680701-21680723 CTCATTCTAGGGATGGAGCAAGG + Intergenic
1187722899 X:22170447-22170469 TTCATTCTTCAGATGAAGAAAGG - Intronic
1188077075 X:25791131-25791153 TTCATTATACAGATTGAAAAAGG + Intergenic
1189030993 X:37450293-37450315 CTCACTTTGCAGATGAGGAAAGG - Intronic
1189300050 X:39945925-39945947 CCCATTTTACAAATGAGGAAAGG - Intergenic
1190283668 X:48948042-48948064 CTCACTTTACAAAGGCAGAAAGG + Intronic
1190301871 X:49061801-49061823 CCCATTTTAGAGATGAGGAAAGG - Intronic
1192046316 X:67677787-67677809 CTCATTTTACAGATAGGAAAGGG - Intronic
1192072376 X:67954613-67954635 CTCATATGACAGATAGGGAAGGG + Intergenic
1192239514 X:69318288-69318310 CTCTTTTGACAGATGGGAAAAGG + Intergenic
1192314461 X:70041233-70041255 CTCATTTTATAGAAGAAGAAAGG + Exonic
1193416769 X:81235061-81235083 TTCATTTGACAGATAAAGAAAGG - Intronic
1194376515 X:93140524-93140546 GTCATTTTATAGTTGTAGAAAGG - Intergenic
1194449858 X:94031368-94031390 CTCACTTGAGAGATGGAAAAAGG - Intergenic
1194567941 X:95517026-95517048 CTTTGTTTCCAGATGGAGAAGGG + Intergenic
1194871657 X:99140280-99140302 TTCATTTTACAGATGTAAAATGG - Intergenic
1194960878 X:100234286-100234308 CTGACTTTGAAGATGGAGAAAGG + Intergenic
1195070615 X:101275640-101275662 CCCATTTTATAGATAAAGAATGG - Intronic
1195283839 X:103363235-103363257 CACATTTTAGAGATGGATACTGG + Intergenic
1195434795 X:104829621-104829643 CACATTTTATAAATGGACAAAGG - Intronic
1195963838 X:110412532-110412554 CCCATTTTACAGATGAGAAACGG - Intronic
1195974607 X:110512783-110512805 CCCATTTTACAGATGAAAACAGG - Intergenic
1196016767 X:110947859-110947881 CTCATTTTAAAGAGGGGGGAAGG - Intronic
1196398555 X:115290688-115290710 CTGACTTTAGAAATGGAGAAGGG + Intronic
1196925309 X:120628453-120628475 CTCATTTTACAGAGAGGAAATGG + Intronic
1196975129 X:121150947-121150969 CCCATTTTACAGATGAGGATGGG - Intergenic
1197149362 X:123203386-123203408 CTTATTTTACAAATGGGAAAAGG - Intronic
1197489058 X:127094077-127094099 TTCATTTTCCAAATGGATAAAGG + Intergenic
1198025375 X:132700715-132700737 TTCAATCTTCAGATGGAGAATGG + Intronic
1198055180 X:132987142-132987164 CACATTTTACAGATGGGGAAAGG - Intergenic
1198434273 X:136600080-136600102 TCCATTGTACAGATGGGGAATGG + Intergenic
1198948064 X:142037828-142037850 CACATTTAACAGATGGGGAGAGG - Intergenic
1199244970 X:145593231-145593253 CCCATTTTACAGATAGTAAAAGG - Intergenic
1199403359 X:147426673-147426695 CTCATTTGAGAGCTGGAGATGGG + Intergenic
1199474304 X:148228984-148229006 CTCATTATACTGATGGAAAGAGG + Intergenic
1200375800 X:155778754-155778776 AACATTTTATAGCTGGAGAAAGG + Exonic
1200586326 Y:5008999-5009021 CTCATTTTACAGATAAGAAAAGG + Intronic
1201236155 Y:11914039-11914061 CTGGCTTTGCAGATGGAGAAAGG + Intergenic