ID: 1091957322

View in Genome Browser
Species Human (GRCh38)
Location 12:4657597-4657619
Sequence CTGTTGTAATAAATGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 794
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 768}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091957322 Original CRISPR CTGTTGTAATAAATGGAGCT TGG Intronic
900841821 1:5055614-5055636 CTTATTTAATAAATGGTGCTGGG + Intergenic
902207543 1:14880349-14880371 ATGTAGTAATTAGTGGAGCTAGG + Intronic
902474726 1:16676356-16676378 CTTATTTAATAAATGGTGCTGGG + Intergenic
903504418 1:23823219-23823241 ATGTTCTAATAAAAGCAGCTTGG - Intronic
905859919 1:41343368-41343390 CTGCCTTAATAAAAGGAGCTGGG + Intergenic
905896577 1:41550107-41550129 CTTTTTTAATAAATGGTGCTGGG - Intronic
905962386 1:42054503-42054525 CCTTTTTAATAAATGGTGCTGGG - Intergenic
906004843 1:42459700-42459722 CCATTGTAATTAATCGAGCTCGG + Exonic
906599644 1:47114203-47114225 CCTTTTTAATAAATGGTGCTAGG + Intronic
907549838 1:55295644-55295666 CCTATGTAATAAATGGTGCTGGG + Intergenic
908643735 1:66254363-66254385 CAGTTGTGATAAATGGAGTGTGG - Intronic
909082015 1:71123764-71123786 CTTATTTAATAAATGGTGCTGGG + Intergenic
909084088 1:71151191-71151213 CTTATTTAATAAATGGTGCTGGG + Intergenic
909297304 1:73967176-73967198 TTCCTGTAATAAATGGTGCTGGG + Intergenic
909315188 1:74208207-74208229 GTGTTTTAATAAAAGGATCTAGG + Intronic
909374902 1:74928825-74928847 CTTATTTAATAAATGGTGCTGGG + Intergenic
909678626 1:78266098-78266120 CTTATTTAATAAATGGTGCTGGG - Intergenic
909868209 1:80702635-80702657 GTGCTTTAATAAATGGTGCTGGG + Intergenic
910451465 1:87350884-87350906 CCTTTGTAATAAAAGCAGCTTGG - Intergenic
911545957 1:99217354-99217376 CTGTTCAATTAAATTGAGCTTGG + Intergenic
911604771 1:99891480-99891502 CAGTTATAATAAATGGAAATCGG + Intronic
911652577 1:100406612-100406634 CCTTTTTAATAAATGGTGCTGGG - Intronic
911714660 1:101117488-101117510 CTGTTGTAGGAAAAGGAGCATGG + Intergenic
911794906 1:102063334-102063356 CCTTTTTAATAAATGGTGCTAGG + Intergenic
911824377 1:102462606-102462628 CTTATTTAATAAATGGTGCTGGG - Intergenic
912034295 1:105291874-105291896 CTTATTTAATAAATGGTGCTGGG - Intergenic
912108593 1:106312419-106312441 CCTATTTAATAAATGGAGCTGGG - Intergenic
912614162 1:111080178-111080200 CTGTTGTAATAAATACAGAATGG - Intergenic
912880929 1:113413110-113413132 CCTATGTAATAAATGGTGCTGGG - Intronic
912885941 1:113474496-113474518 CCTATGTAATAAATGGTGCTGGG - Intronic
912896846 1:113600978-113601000 CCTATGTAATAAATGGTGCTGGG + Intronic
912899675 1:113634467-113634489 CCTATGTAATAAATGGTGCTGGG - Intronic
913525867 1:119692326-119692348 CTTATTTAATAAATGGTGCTGGG - Intronic
913647432 1:120872092-120872114 CTTATTTAATAAATGGTGCTGGG - Intergenic
913694427 1:121310657-121310679 CTTATTTAATAAATGGTGCTGGG - Intronic
914218972 1:145660210-145660232 CTTATTTAATAAATGGTGCTGGG + Intronic
914951339 1:152117355-152117377 CTGTTATAATAAATGCAATTTGG - Intergenic
915045077 1:153005855-153005877 CTTATTTAATAAATGGTGCTGGG - Intergenic
915051546 1:153079597-153079619 CTTATTTAATAAATGGTGCTGGG - Intergenic
915690331 1:157682476-157682498 CTTTATTAATAAATGGTGCTGGG - Intronic
915794129 1:158708822-158708844 CCTATTTAATAAATGGAGCTGGG - Intergenic
916829805 1:168479259-168479281 CTTATTTAATAAATGGTGCTGGG + Intergenic
916916533 1:169412782-169412804 CTTATTTAATAAATGGTGCTGGG + Intronic
916976874 1:170090406-170090428 CCTATGTAATAAATGGTGCTGGG - Intergenic
916990275 1:170236009-170236031 CCTATGTAATAAATGGTGCTGGG + Intergenic
917022878 1:170609464-170609486 CTTATTTAATAAATGGTGCTGGG - Intergenic
917127383 1:171699345-171699367 CTGTTGTTAGAAATGGAGACAGG - Intergenic
917192848 1:172436500-172436522 CTGATTTAATAAATGGTGCTGGG + Intronic
917538118 1:175889129-175889151 CTGTTTCAGTGAATGGAGCTGGG + Intergenic
918219291 1:182421315-182421337 CTTATTTAATAAATGGTGCTGGG - Intergenic
918313711 1:183305271-183305293 CTGTGGTACTAAATATAGCTGGG + Intronic
918775240 1:188620417-188620439 CTGTGGAAGTAAATGGAACTGGG + Intergenic
919021534 1:192112115-192112137 CTGTTGAAATAAATGAAGTGAGG - Intergenic
919176140 1:194020839-194020861 ATGTTATAATAATTGGAGATGGG + Intergenic
919368550 1:196696913-196696935 CTTATTTAATAAATGGTGCTGGG + Intronic
919437039 1:197574850-197574872 CCGATTTAATAAATGGTGCTGGG + Intronic
919584338 1:199417455-199417477 CTTTTTCAATAAATGGTGCTGGG + Intergenic
919888449 1:201952328-201952350 CTGTTGGAATTAAATGAGCTGGG + Intergenic
921298911 1:213731004-213731026 CTGATTCAATAAATGGTGCTGGG - Intergenic
922200523 1:223396766-223396788 CCTTTTTAATAAATGGTGCTGGG - Intergenic
922393599 1:225173017-225173039 CTTATTTAATAAATGGTGCTGGG + Intronic
923431266 1:233922880-233922902 CCGATTTAATAAATGGTGCTGGG - Intronic
923443503 1:234044440-234044462 ATTTTGTAATAAATGGAGCTAGG + Intronic
923444018 1:234050870-234050892 CCGATTTAATAAATGGTGCTGGG - Intronic
923947564 1:238905169-238905191 CCTTTTTAATAAATGGTGCTGGG + Intergenic
924274588 1:242372701-242372723 CCGATTTAATAAATGGTGCTGGG + Intronic
924857545 1:247889551-247889573 CCTTTTTAATAAATGGTGCTGGG - Intergenic
924884112 1:248193858-248193880 CCTTTTTAATAAATGGTGCTGGG + Intergenic
924893468 1:248309850-248309872 CTGTTCTATGAAATGGTGCTGGG - Intergenic
1062781059 10:208055-208077 CTTATTTAATAAATGGTGCTGGG + Intronic
1062851753 10:748859-748881 CCCTTTTAATAAATGGTGCTGGG + Intergenic
1063744503 10:8864756-8864778 CCTATTTAATAAATGGAGCTGGG - Intergenic
1063744714 10:8867396-8867418 CTGTTGTATTAAAAGGATCTAGG + Intergenic
1064077899 10:12284852-12284874 CCTATTTAATAAATGGAGCTGGG - Intergenic
1064771288 10:18726290-18726312 CCTGTTTAATAAATGGAGCTGGG - Intergenic
1064794609 10:18997340-18997362 CTTATTTAATAAATGGTGCTGGG + Intergenic
1064968500 10:21039456-21039478 CTTGTTTAATAAATGGTGCTGGG - Intronic
1065416702 10:25496002-25496024 TGGTTGTCATAACTGGAGCTGGG - Intronic
1065982775 10:30918033-30918055 GTGTTGCAGTAAATGGTGCTGGG - Intronic
1066786612 10:39011306-39011328 CCTATGTAATAAATGGTGCTGGG - Intergenic
1066799305 10:39166645-39166667 CTTATTTAATAAATGGTGCTGGG + Intergenic
1066930670 10:41754103-41754125 CTTATTTAATAAATGGTGCTGGG + Intergenic
1068023336 10:51611869-51611891 CCTTTTTAATAAATGGTGCTAGG - Intronic
1068185302 10:53577484-53577506 CTTATTTAATAAATGGTGCTGGG + Intergenic
1069260360 10:66386854-66386876 CTTATTTAATAAATGGTGCTGGG + Intronic
1069263545 10:66430661-66430683 CTTATTTAATAAATGGTGCTGGG + Intronic
1069278126 10:66618468-66618490 CCCTTTTAATAAATGGTGCTGGG + Intronic
1069355475 10:67580288-67580310 CTTATTTAATAAATGGTGCTGGG - Intronic
1069363595 10:67672592-67672614 CCTTTTTAATAAATGGTGCTGGG - Intronic
1070050180 10:72881169-72881191 CTTTTTCAATAAATGGTGCTAGG + Intronic
1070294872 10:75152024-75152046 TGTTTGTAATAAATGGAACTTGG + Intronic
1071059492 10:81553030-81553052 CTTATTTAATAAATGGTGCTGGG + Intergenic
1072953057 10:99865025-99865047 CTAATTTAATAAATGGTGCTGGG - Intergenic
1073040201 10:100598973-100598995 CAGTTGAAATAAAAGAAGCTAGG - Intergenic
1073924374 10:108497942-108497964 CTTATTTAATAAATGGTGCTGGG + Intergenic
1075088968 10:119432285-119432307 CTGTTATAAAAAATAAAGCTGGG + Intronic
1076320501 10:129577444-129577466 CTTATTTAATAAATGGTGCTGGG + Intronic
1076418307 10:130308403-130308425 CTGTTGGTATAAATGAATCTTGG + Intergenic
1077597730 11:3548257-3548279 CAGTTGGGATAGATGGAGCTGGG - Intergenic
1077742219 11:4858980-4859002 CCTATTTAATAAATGGAGCTGGG + Intronic
1077743051 11:4868976-4868998 CCTATTTAATAAATGGAGCTGGG + Intronic
1077750615 11:4964344-4964366 CTTATTTAATAAATGGTGCTAGG - Intronic
1078870419 11:15339094-15339116 CTATTCTAACAAATGGAGCATGG - Intergenic
1079680650 11:23293060-23293082 CCTTTTTAATAAATGGTGCTGGG + Intergenic
1079756339 11:24268660-24268682 CCTATGTAATAAATGGTGCTGGG - Intergenic
1079764269 11:24371099-24371121 CTTATTTAATAAATGGTGCTGGG - Intergenic
1079782845 11:24630421-24630443 CCTTTGTAATAAATGGTGCTAGG - Intronic
1079843235 11:25429906-25429928 CTATTTAAATAAATGGTGCTGGG + Intergenic
1080238765 11:30102437-30102459 CCTTTTTAATAAATGGTGCTGGG + Intergenic
1080297937 11:30751697-30751719 CTGTGGTCACATATGGAGCTAGG - Intergenic
1080732935 11:34979038-34979060 ATGTGGTAGCAAATGGAGCTAGG + Intronic
1080900219 11:36482741-36482763 CTTATTTAATAAATGGTGCTGGG + Intergenic
1081103746 11:39038107-39038129 TTGTTATCATAAATGTAGCTAGG + Intergenic
1081309173 11:41549684-41549706 CTTATTTAATAAATGGTGCTGGG + Intergenic
1081313603 11:41603832-41603854 CTTATTTAATAAATGGTGCTGGG + Intergenic
1082586898 11:54951735-54951757 CTTATTTAATAAATGGTGCTGGG + Intergenic
1082600008 11:55137599-55137621 CTTATTTAATAAATGGCGCTGGG + Intergenic
1082754630 11:57062362-57062384 CTTCTTTAATAAATGGTGCTGGG + Intergenic
1082900867 11:58250278-58250300 CCTTTTTAATAAATGGCGCTGGG - Intergenic
1083345731 11:61990194-61990216 CCTTTTTAATAAATGGTGCTGGG + Intergenic
1083500940 11:63107163-63107185 CTATTTTAATAAATGTTGCTGGG - Intronic
1083552483 11:63600283-63600305 CTGTTTTAAAAAATGCAGCATGG - Intronic
1085149849 11:74242209-74242231 CCTTTTCAATAAATGGAGCTGGG - Intronic
1085491983 11:76928693-76928715 CTTATTTAATAAATGGTGCTGGG - Intronic
1085495862 11:76968701-76968723 CTTATTTAATAAATGGTGCTGGG + Intronic
1086050205 11:82580408-82580430 CTTCTTTAATAAATGGTGCTGGG + Intergenic
1086304647 11:85466542-85466564 CTTATTTAATAAATGGTGCTGGG - Intronic
1086531472 11:87791446-87791468 CTTATTTAATAAATGGTGCTGGG + Intergenic
1086531480 11:87791531-87791553 CTTATTTAATAAATGGTGCTGGG + Intergenic
1086659366 11:89395736-89395758 CCTATTTAATAAATGGAGCTGGG - Intronic
1086741541 11:90375689-90375711 CCTATTTAATAAATGGAGCTGGG - Intergenic
1086765087 11:90686927-90686949 CTTATTTAATAAATGGTGCTGGG - Intergenic
1087504407 11:99001344-99001366 CCTTTTTAATAAATGGTGCTGGG + Intergenic
1087646728 11:100816803-100816825 GTGTTGTTGTAACTGGAGCTTGG + Intronic
1087739941 11:101875688-101875710 CTTATTTAATAAATGGTGCTGGG - Intergenic
1087741900 11:101897588-101897610 CCTTTTTAATAAATGGTGCTGGG - Intronic
1087878483 11:103387734-103387756 CTATTTTAATAAATGGTGCTGGG - Intronic
1087881028 11:103416569-103416591 CCTTTTTAATAAATGGTGCTGGG + Intronic
1088376868 11:109150856-109150878 CTGTTATATTAAGTGGATCTTGG + Intergenic
1089177771 11:116560768-116560790 CTGTTCTAATAAAATTAGCTTGG - Intergenic
1089999060 11:122938115-122938137 CTGTTTTCATAGATTGAGCTGGG + Intronic
1090313145 11:125760859-125760881 CCTATTTAATAAATGGAGCTGGG + Intergenic
1090567550 11:128011509-128011531 CATTTTTAATAAATGGTGCTGGG + Intergenic
1090587036 11:128224009-128224031 CTTATTTAATAAATGGTGCTGGG + Intergenic
1090606487 11:128427461-128427483 CTTATTTAATAAATGGTGCTGGG - Intergenic
1091329633 11:134721382-134721404 CTTATTTAATAAATGGTGCTGGG - Intergenic
1091575879 12:1734835-1734857 CCTATGTAATAAATGGTGCTGGG - Intronic
1091957322 12:4657597-4657619 CTGTTGTAATAAATGGAGCTTGG + Intronic
1093571137 12:20667505-20667527 CTTTTTTAATAAGTGGTGCTGGG - Intronic
1093611940 12:21171580-21171602 CTCTTGCAATAATTGAAGCTAGG + Intronic
1093655783 12:21692925-21692947 CTTATTTAATAAATGGGGCTGGG + Intronic
1094869280 12:34581048-34581070 CTTATTTAATAAATGGTGCTGGG - Intergenic
1095705980 12:45237456-45237478 CTTATTTAATAAATGGTGCTGGG - Intronic
1095867389 12:46987406-46987428 CCCATTTAATAAATGGAGCTAGG + Intergenic
1095879547 12:47118423-47118445 CTTATTTAATAAATGGTGCTGGG - Intronic
1096034390 12:48452243-48452265 CTTATTTAATAAATGGTGCTGGG + Intergenic
1096877133 12:54638392-54638414 CTTATTTAATAAATGGTGCTGGG + Intergenic
1096920259 12:55076724-55076746 CTTATTTAATAAATGGTGCTGGG - Intergenic
1097149460 12:56965843-56965865 CCTATGTAATAAATGGTGCTGGG + Intergenic
1097309251 12:58100543-58100565 ATGTAGTAATAACTGAAGCTGGG - Intergenic
1097344159 12:58472640-58472662 CCCATGTAATAAATGGTGCTGGG - Intergenic
1097530436 12:60793154-60793176 CTTATTTAATAAATGGTGCTGGG - Intergenic
1097531710 12:60809806-60809828 CTTATTTAATAAATGGTGCTGGG - Intergenic
1097576535 12:61400845-61400867 CCCATGTAATAAATGGTGCTGGG - Intergenic
1097581747 12:61465717-61465739 CTTATTTAATAAATGGTGCTGGG + Intergenic
1098120079 12:67227328-67227350 CCTATGTAATAAATGGTGCTGGG - Intergenic
1098452135 12:70631337-70631359 CCTATTTAATAAATGGAGCTGGG + Intronic
1098776588 12:74628099-74628121 CTTATCTAATAAATGGTGCTGGG - Intergenic
1099059001 12:77882339-77882361 CTATTTCAATAAATGGTGCTGGG + Intronic
1099073092 12:78071706-78071728 CTTATTTAATAAATGGCGCTGGG - Intronic
1099268832 12:80482283-80482305 CTTATTTAATAAATGGTGCTGGG + Intronic
1099409388 12:82305881-82305903 CCTATGTAATAAATGGTGCTGGG + Intronic
1099587584 12:84540510-84540532 CTTTTGCAATAAATGGTTCTGGG - Intergenic
1099820025 12:87697502-87697524 CTTATTTAATAAATGGTGCTGGG - Intergenic
1100720272 12:97350641-97350663 CCTATGTAATAAATGGTGCTGGG - Intergenic
1100876279 12:98965806-98965828 CTTATTTAATAAATGGTGCTGGG + Intronic
1103010270 12:117452900-117452922 CTGTTGTAAGCTATGGAGTTTGG + Intergenic
1103168709 12:118794341-118794363 CTTATTTAATAAATGGTGCTGGG - Intergenic
1104392268 12:128400913-128400935 CTGTTGTCAAGAATGGGGCTGGG - Intronic
1104741818 12:131182640-131182662 CTGATTCAATAAATGGGGCTGGG + Intergenic
1108516952 13:51212448-51212470 TTGTTTTAGTAAATGGAACTGGG - Intergenic
1108865942 13:54922642-54922664 CTTATTTAATAAATGGTGCTGGG + Intergenic
1108917623 13:55635183-55635205 CTTATTTAATAAATGGTGCTGGG - Intergenic
1108989616 13:56638759-56638781 CCCTTTTAATAAATGGTGCTGGG - Intergenic
1109081259 13:57904224-57904246 CTTATTTAATAAATGGTGCTAGG + Intergenic
1109096817 13:58129337-58129359 CTTATTTAATAAATGGTGCTGGG - Intergenic
1109127623 13:58537486-58537508 CTTATTTAATAAATGGTGCTGGG - Intergenic
1109146481 13:58786119-58786141 CTTATTTAATAAATGGTGCTCGG - Intergenic
1109227462 13:59714057-59714079 CTGTTTTAAAAAATTTAGCTAGG + Intronic
1109531441 13:63653851-63653873 CTTATGTAATAAATGATGCTGGG - Intergenic
1109565897 13:64116125-64116147 CTTATTTAATAAATGGTGCTGGG - Intergenic
1109637518 13:65141968-65141990 CTATTGTAATATATGTAGGTAGG - Intergenic
1109659572 13:65440290-65440312 CTTGTTTAATAAATGGTGCTGGG + Intergenic
1109816647 13:67593227-67593249 CCTATGTAATAAATGGTGCTGGG + Intergenic
1109870696 13:68328558-68328580 CTTATTTAATAAATGGTGCTGGG - Intergenic
1110001941 13:70213633-70213655 CTTATTTAATAAATGGTGCTGGG + Intergenic
1110258084 13:73454217-73454239 CCCTTTTAATAAATGGTGCTGGG - Intergenic
1110336671 13:74340472-74340494 CTTTTTTAATAAATGGTGCTGGG - Intergenic
1110659974 13:78048869-78048891 CTTGTTTAATAAATGGTGCTGGG - Intergenic
1111342003 13:86898781-86898803 CTTATTTAATAAATGGTGCTGGG + Intergenic
1111922392 13:94426073-94426095 ATTGTCTAATAAATGGAGCTTGG - Intergenic
1112069259 13:95830038-95830060 CTTATTTAATAAATGGTGCTGGG + Intronic
1112885844 13:104170523-104170545 CTGTTGTACTATTTGTAGCTTGG - Intergenic
1112932306 13:104756777-104756799 CTGTTGTAAGACATGTAGCAAGG + Intergenic
1112972368 13:105275901-105275923 CTTTTTTAAAAAATGGTGCTAGG + Intergenic
1113173678 13:107535985-107536007 CTTATTTAATAAATGGTGCTGGG + Intronic
1114346878 14:21805797-21805819 CTGATTTAATAAATGGTGTTGGG + Intergenic
1115578870 14:34738458-34738480 CTTATTTAATAAATGGTGCTGGG - Intergenic
1115708641 14:36025808-36025830 CTCTTCAAATAAATGGTGCTAGG - Intergenic
1115838725 14:37441465-37441487 CCTTTTTAATAAATGGTGCTGGG - Intronic
1116063456 14:39952957-39952979 CCTTTTTAATAAATGGTGCTGGG + Intergenic
1116476878 14:45350419-45350441 CTTATTTAATAAATGGTGCTGGG - Intergenic
1116705253 14:48287717-48287739 CTTATTTAATAAATGGTGCTGGG + Intergenic
1117123233 14:52592057-52592079 CCTATGTAATAAATGGTGCTGGG - Intronic
1117173092 14:53120706-53120728 CTTATTTAATAAATGGTGCTGGG + Intronic
1117614022 14:57514703-57514725 CCTATGTAATAAATGGTGCTGGG - Intergenic
1117829667 14:59737920-59737942 CCTATGTAATAAATGGTGCTGGG + Intronic
1118076642 14:62306906-62306928 CCTATGTAATAAATGGTGCTGGG - Intergenic
1118674087 14:68163918-68163940 ATACTGTAATAAATGGTGCTGGG + Intronic
1119594469 14:75921457-75921479 CCTTTTTAATAAATGGTGCTGGG - Intronic
1120541932 14:85761502-85761524 ATGTGGGAATGAATGGAGCTTGG + Intergenic
1120605269 14:86568346-86568368 ATGTTGTTATAAATGTAGTTCGG - Intergenic
1120608515 14:86609710-86609732 CCTTTTTAATAAATGGTGCTGGG - Intergenic
1120742485 14:88123440-88123462 CCTTTTTAATAAATGGTGCTGGG - Intergenic
1121243816 14:92448762-92448784 CTGTCCTAATAAAGGAAGCTCGG - Intronic
1121804803 14:96808382-96808404 TTTTTTTAATCAATGGAGCTTGG - Intronic
1122259661 14:100507137-100507159 CCTTTGCAATAAATGGTGCTGGG - Intronic
1122832323 14:104405175-104405197 CTGTTGTGATCACTGGGGCTTGG + Intergenic
1123541412 15:21295431-21295453 CCGATTTAATAAATGGTGCTGGG + Intergenic
1124674406 15:31671304-31671326 CTTATTTAATAAATGGTGCTGGG - Intronic
1125088228 15:35757478-35757500 CAGTTGGAAATAATGGAGCTTGG - Intergenic
1125396876 15:39258567-39258589 CTATTTAAATAAATGGTGCTGGG + Intergenic
1125413087 15:39425333-39425355 CCTATGTAATAAATGGTGCTGGG + Intergenic
1125467701 15:39971087-39971109 CCGTTGTAATGAAAGTAGCTTGG + Intronic
1126002684 15:44226288-44226310 CCTATGTAATAAATGGTGCTGGG + Intergenic
1126722452 15:51595828-51595850 CTTATTTAATAAATGGTGCTGGG + Intronic
1126897843 15:53278932-53278954 CTTGTTTAATAAATGGTGCTAGG + Intergenic
1126900221 15:53307257-53307279 CTATAGGAAGAAATGGAGCTTGG + Intergenic
1127751474 15:62049336-62049358 CCTATGTAATAAATGGTGCTGGG - Intronic
1127756772 15:62100075-62100097 CCTATGTAATAAATGGTGCTGGG + Intergenic
1127970750 15:63958586-63958608 CCTTTTTAATAAATGGTGCTGGG - Intronic
1130197140 15:81790754-81790776 GTGATCTAATAAATGGTGCTTGG + Intergenic
1130391992 15:83464857-83464879 CTGTTTTAAAAAATGTATCTCGG + Intronic
1130786987 15:87109516-87109538 CTTCTTTAATAAATGGTGCTTGG + Intergenic
1202949725 15_KI270727v1_random:22572-22594 CCGATTTAATAAATGGTGCTGGG + Intergenic
1133572239 16:7052699-7052721 GTTTGGTTATAAATGGAGCTTGG + Intronic
1133953994 16:10423836-10423858 CTGTGGTAAGAAGGGGAGCTCGG - Intronic
1136706403 16:32191400-32191422 CTATTGTAAGAAATGGACATTGG - Intergenic
1136761506 16:32738017-32738039 CTATTGTAAGAAATGGACATTGG + Intergenic
1136806596 16:33132373-33132395 CTATTGTAAGAAATGGACATTGG - Intergenic
1137946565 16:52738360-52738382 TTATTTTAATAAATGGTGCTGGG + Intergenic
1137972395 16:52999065-52999087 CTTATTTAATAAATGGTGCTGGG + Intergenic
1138259386 16:55603557-55603579 CTATTTAAATAAATGGTGCTGGG + Intergenic
1138643684 16:58406987-58407009 GAGTTGTAAAAAATGGAGATGGG - Intergenic
1140301457 16:73761742-73761764 CCTATGTAATAAATGGTGCTGGG + Intergenic
1203063661 16_KI270728v1_random:998332-998354 CTATTGTAAGAAATGGACATTGG + Intergenic
1144052744 17:11510986-11511008 CTCTTCTGTTAAATGGAGCTAGG + Intronic
1144340723 17:14308995-14309017 TTGATTTAATGAATGGAGCTGGG + Intronic
1144635189 17:16902328-16902350 CCTCTGTAATAAATGGTGCTGGG + Intergenic
1146841343 17:36157196-36157218 ATGTTGGAATAAATGGTCCTGGG - Intergenic
1146853593 17:36244833-36244855 ATGTTGGAATAAATGGTCCTGGG - Intronic
1146869502 17:36368725-36368747 ATGTTGGAATAAATGGTCCTGGG - Intronic
1147072377 17:37969349-37969371 ATGTTGGAATAAATGGTCCTGGG - Intergenic
1147083901 17:38048886-38048908 ATGTTGGAATAAATGGTCCTGGG - Intronic
1147099847 17:38172853-38172875 ATGTTGGAATAAATGGTCCTGGG - Intergenic
1147461473 17:40573495-40573517 CTTATTTAATAAATGGTGCTGGG + Intergenic
1149182748 17:53958858-53958880 CTGTTCAAAAAAATGGTGCTGGG + Intergenic
1149245833 17:54706657-54706679 CTGGTTCAATAAATGGTGCTGGG - Intergenic
1149572303 17:57681180-57681202 CTGTTATAATATATGGTCCTCGG + Exonic
1149877683 17:60254004-60254026 GTGTTGGAATAAATGGAAATTGG - Intronic
1150082854 17:62256143-62256165 ATGTTGGAATAAATGGTCCTGGG - Intergenic
1150094552 17:62361866-62361888 CCTATGTAATAAATGGTGCTGGG + Intergenic
1150184794 17:63169336-63169358 TTGTAGAAATAAATGAAGCTAGG + Intronic
1150195996 17:63300015-63300037 CTTATTTAATAAATGGTGCTGGG - Intronic
1150328178 17:64273531-64273553 CTGTTCTAAGAAATGTAGCCTGG - Intergenic
1150876818 17:68979692-68979714 CTTATTTAATAAATGGTGCTGGG + Intronic
1203162659 17_GL000205v2_random:64953-64975 CTTATTTAATAAATGGTGCTGGG - Intergenic
1153326378 18:3824783-3824805 CAGGTGTTATAAATGTAGCTTGG - Intronic
1154320880 18:13350862-13350884 CCTATTTAATAAATGGAGCTGGG - Intronic
1156950421 18:42890056-42890078 ATGTTGTAATATAAGAAGCTGGG + Intronic
1157682180 18:49615820-49615842 CTGTTTTAATCAATGGGGGTTGG + Intergenic
1158704148 18:59776214-59776236 CTTATTTAATAAATGGTGCTGGG + Intergenic
1159038857 18:63303812-63303834 ATGTTGTCATAAATGGAAATGGG + Intronic
1159308448 18:66676906-66676928 CTGTTTTAATCAATGGATATTGG + Intergenic
1159928529 18:74290543-74290565 CTGTTTTAAAAAATGAGGCTGGG - Intronic
1159964775 18:74584549-74584571 TTCTTGTGATTAATGGAGCTGGG - Exonic
1161566003 19:5003177-5003199 TTTTTTTAATCAATGGAGCTGGG - Intronic
1162542340 19:11304944-11304966 TTTTTTTAATAAATGAAGCTGGG - Intronic
1162787717 19:13046030-13046052 CTGCTCTGAGAAATGGAGCTGGG + Intronic
1163208910 19:15825710-15825732 CTATTTTAAAAAATGGTGCTGGG + Intergenic
1163914611 19:20229775-20229797 CCGATTTAATAAATGGTGCTGGG + Intergenic
1164002103 19:21110819-21110841 CCCTTTTAATAAATGGTGCTGGG - Intronic
1164008721 19:21177261-21177283 CCCTTTTAATAAATGGTGCTGGG - Intronic
1164046575 19:21548109-21548131 CCTTTTTAATAAATGGTGCTGGG - Intronic
1164094162 19:21990316-21990338 CTTATTTAATAAATGGTGCTGGG - Intronic
1164195529 19:22954422-22954444 CTTATTTAATAAATGGTGCTGGG + Intergenic
1164357698 19:27461342-27461364 CTTATTTAATAAATGGTGCTGGG - Intergenic
1164358344 19:27468475-27468497 CCTTTTTAATAAATGGTGCTGGG + Intergenic
1164360631 19:27504324-27504346 CAGATTTAATAAATGGTGCTGGG + Intergenic
1164367115 19:27597603-27597625 CTTATTTAATAAATGGTGCTGGG - Intergenic
1166322921 19:42030146-42030168 CTATTCAAGTAAATGGAGCTGGG + Intronic
1167717028 19:51149385-51149407 CTGATTCAATAAATGGTGCTGGG - Intronic
1167876289 19:52415827-52415849 CAGTTGTAATAAATGTGGCAAGG + Exonic
1168010284 19:53524997-53525019 CGTTTTTAATAAATGGTGCTGGG - Intronic
925561641 2:5202699-5202721 CTGTTGTACTCAATGGATCTGGG + Intergenic
926418827 2:12677539-12677561 CTGTTATAATGAAGGGATCTGGG - Intergenic
926539558 2:14158621-14158643 CTTTTTTAATAAATGGTGCTGGG - Intergenic
927282957 2:21326782-21326804 CTGCTGCACTAAATGGAGCGAGG - Intergenic
928146711 2:28785040-28785062 ATGTTGTAATAAATTGTGTTAGG + Intronic
928878148 2:36065428-36065450 CTTATTTAATAAATGGTGCTGGG + Intergenic
929813990 2:45216434-45216456 CTGTTTTAATTACTGTAGCTTGG - Intergenic
930568086 2:53048567-53048589 CTCGTTTAATAAATGGTGCTGGG + Intergenic
930803497 2:55467054-55467076 CATTTTTAATAAATGGTGCTGGG + Intergenic
930973360 2:57423474-57423496 CTTATTTAATAAATGGTGCTGGG + Intergenic
931536302 2:63280737-63280759 CCGTTTCAATAAATGGTGCTGGG + Intronic
931558920 2:63535620-63535642 CTATTACAATAAATGGTGCTAGG + Intronic
931871101 2:66460613-66460635 CTATTGTCATAAATGGAGGCAGG - Intronic
932594171 2:73083870-73083892 CTATTGTCATAAAGGGGGCTGGG - Intronic
933533341 2:83538385-83538407 CTGTTGTTCTAACTGTAGCTTGG - Intergenic
934115977 2:88793934-88793956 CTTATTTAATAAATGGTGCTGGG + Intergenic
934511802 2:94950657-94950679 CTTATTTAATAAATGGTGCTGGG - Intergenic
935863171 2:107356490-107356512 CTGATTTATTAAGTGGAGCTTGG + Intergenic
935886418 2:107624479-107624501 CTGTTAAAGAAAATGGAGCTAGG + Intergenic
936590680 2:113800964-113800986 CCGTTTTAACAAATGGTGCTGGG - Intergenic
936752897 2:115667574-115667596 CCTTTTTAATAAATGGTGCTGGG - Intronic
936781493 2:116038427-116038449 CCTATTTAATAAATGGAGCTGGG + Intergenic
936782409 2:116050176-116050198 CCTATTTAATAAATGGAGCTGGG - Intergenic
936847129 2:116850607-116850629 CGGCTGTAATAAATGAATCTGGG - Intergenic
938015403 2:127863130-127863152 CTGTTGTACAAATTGGAGGTGGG + Exonic
938586972 2:132700557-132700579 CCGATTTAATAAATGGTGCTGGG - Intronic
939923397 2:148144680-148144702 CTTATTTAATAAATGGTGCTGGG - Intronic
941563552 2:167079370-167079392 CTGTTCTAAAAAATTGAGCGGGG - Intronic
941629180 2:167865494-167865516 CTATTGAAATAAATGGGGCCGGG + Intergenic
942746738 2:179242710-179242732 CTATTCAAATAAATGGTGCTGGG + Intronic
942827300 2:180194057-180194079 CCCTTTTAATAAATGGTGCTGGG - Intergenic
942863167 2:180640393-180640415 CCTATGTAATAAATGGTGCTGGG - Intergenic
942984229 2:182120139-182120161 CTTATTTAATAAATGGTGCTGGG - Intronic
943136061 2:183914377-183914399 CTTATTTAATAAATGGTGCTGGG - Intergenic
943184824 2:184594780-184594802 CTGTTGTATTAAATTAAGTTGGG - Intergenic
943349118 2:186777101-186777123 CTGTGGTAATCAATAGAGCATGG + Intergenic
944156785 2:196615932-196615954 ATGATGCAATAAATGGTGCTGGG - Intergenic
944267788 2:197747922-197747944 CTTGTTTAATAAATGGTGCTGGG + Intronic
944455659 2:199891502-199891524 CCTATGTAATAAATGGTGCTGGG + Intergenic
944600158 2:201295419-201295441 CTTATTTAATAAATGGTGCTTGG + Intronic
945210530 2:207377698-207377720 CCTATTTAATAAATGGAGCTGGG - Intergenic
945355661 2:208836479-208836501 CCTTTTTAATAAATGGTGCTGGG + Intronic
945520438 2:210820923-210820945 CTTGTTTAATAAATGGTGCTGGG + Intergenic
946636119 2:221729227-221729249 CTTATTTAATAAATGGTGCTGGG + Intergenic
947891259 2:233622958-233622980 CTTATTTAATAAATGGTGCTGGG - Intronic
947902410 2:233732538-233732560 CTTATTTAATAAATGGTGCTGGG - Intronic
947997248 2:234538633-234538655 ATGTTGTAATAAATGGAAGTGGG - Intergenic
948238732 2:236410804-236410826 CCTTTTTAATAAATGGTGCTGGG + Intronic
948241309 2:236438175-236438197 CCTTTTTAATAAATGGTGCTGGG - Intronic
948746694 2:240101131-240101153 CCTATTTAATAAATGGAGCTGGG + Intergenic
1169602430 20:7276895-7276917 CCTTTTTAATAAATGGTGCTGGG + Intergenic
1170180692 20:13526670-13526692 CTGATGCAAGAAATGGAGCTAGG + Intronic
1170324083 20:15136470-15136492 CCTTTTTAATAAATGGTGCTGGG + Intronic
1170529576 20:17277477-17277499 CCGATTTAATAAATGGTGCTGGG + Intronic
1171076694 20:22134084-22134106 CTTATTTAATAAATGGTGCTGGG + Intergenic
1171193981 20:23182502-23182524 CCTATGTAATAAATGGTGCTGGG - Intergenic
1171515467 20:25728969-25728991 CCGATTTAATAAATGGTGCTGGG + Intergenic
1171777090 20:29378957-29378979 GTTTTGTAATAAATAGGGCTGGG - Intergenic
1171899332 20:30842601-30842623 CTTTTGTAATAAATAGGGCTGGG + Intergenic
1174503704 20:51003562-51003584 CTGTCTTAAAAAAGGGAGCTGGG - Intergenic
1176371397 21:6063971-6063993 CTGTTGTAAAAGATGGACGTAGG - Intergenic
1177022571 21:15881602-15881624 CTTATTTAATAAATGGTGCTAGG - Intergenic
1177202450 21:17973050-17973072 CTTATTTAATAAATGGTGCTGGG + Intronic
1177204683 21:17997477-17997499 TTGTTGTATTATATGGAGATGGG + Intronic
1177279738 21:18965757-18965779 GTATTTTAATAAATGGAGATTGG + Intergenic
1177367716 21:20158818-20158840 CTTATTTAATAAATGGTGCTGGG - Intergenic
1178772191 21:35515899-35515921 CTTATTTAATAAATGGTGCTGGG + Intronic
1178964859 21:37106932-37106954 CTCTTTTAATAAATGGTGCTGGG - Intronic
1179318590 21:40269034-40269056 CTGCTGAAATAAATGGCTCTGGG - Intronic
1179752122 21:43474568-43474590 CTGTTGTAAAAGATGGACGTAGG + Intergenic
1180321918 22:11329791-11329813 TTTTTGTAATAAATAGGGCTGGG - Intergenic
1180333144 22:11550883-11550905 CTTTTGTAATAAATAGGGCTGGG + Intergenic
1182142180 22:27969121-27969143 ACTTTGCAATAAATGGAGCTTGG - Intergenic
1182714521 22:32346612-32346634 CTTATTTAATAAATGGTGCTGGG + Intergenic
1184349521 22:43934543-43934565 ATGCTGAAATAAATGGTGCTTGG + Intronic
949225306 3:1686550-1686572 CTTATTTAATAAATGGTGCTGGG + Intergenic
949423968 3:3896191-3896213 CTTATTTAATAAATGGTGCTGGG - Intronic
949532550 3:4970662-4970684 CTTATTTAATAAATGGTGCTGGG + Intergenic
950815631 3:15699149-15699171 CTTATTTAATAAATGGTGCTGGG + Intronic
951161666 3:19430199-19430221 CTTATTTAATAAATGGTGCTGGG - Intronic
951393692 3:22138575-22138597 CTTATTTAATAAATGGTGCTGGG + Intronic
951849038 3:27118050-27118072 CTTATTTAATAAATGGTGCTGGG - Intronic
952054900 3:29432465-29432487 CTATTGCAAGAAATGAAGCTGGG + Intronic
952318153 3:32250105-32250127 GTCTTTTAATAAATGGTGCTGGG - Intronic
952689458 3:36187646-36187668 CCTTTTTAATAAATGGTGCTGGG - Intergenic
953142266 3:40240140-40240162 CTTATTTAATAAATGGTGCTGGG - Intronic
953371852 3:42395370-42395392 CCGTTGTTAAAAATGGTGCTAGG + Intergenic
954513397 3:51148575-51148597 CCTATGTAATAAATGGTGCTGGG - Intronic
954986123 3:54793733-54793755 CTGATGTAATAAAATGAGTTGGG + Intronic
955121752 3:56066781-56066803 CTTATTTAATAAATGGTGCTGGG - Intronic
955616667 3:60815469-60815491 CTTATTTAATAAATGGCGCTGGG - Intronic
956328322 3:68077541-68077563 CTTATTTAATAAATGGTGCTGGG - Intronic
956354974 3:68381002-68381024 CTTATTTAATAAATGGTGCTGGG - Intronic
956375205 3:68606957-68606979 CTTATTTAATAAATGGTGCTGGG + Intergenic
956461417 3:69476436-69476458 CTTATTTAATAAATGGTGCTGGG - Intronic
957004921 3:74933934-74933956 CCTTTTTAATAAATGGTGCTGGG - Intergenic
957688480 3:83536597-83536619 CCTTTTTAATAAATGGTGCTGGG + Intergenic
957857103 3:85893254-85893276 CTTATTTAATAAATGGTGCTAGG + Intronic
958092370 3:88892982-88893004 CGTATGTAATAAATGGTGCTGGG + Intergenic
958133729 3:89462060-89462082 CTTATTTAATAAATGGTGCTGGG - Intronic
959180155 3:102968947-102968969 CTTATTTAATAAATGGTGCTGGG - Intergenic
959222863 3:103543723-103543745 CTTATTTAATAAATGGTGCTGGG - Intergenic
959259035 3:104051461-104051483 CTTATTTAATAAATGGTGCTTGG + Intergenic
959360943 3:105390827-105390849 CTTATTTAATAAATGGTGCTGGG - Intronic
959408842 3:105995866-105995888 CTTATTTAATAAATGGTGCTGGG + Intergenic
960020095 3:112940077-112940099 CTTCTTTAATAAATGGCGCTGGG + Intronic
961066807 3:123883324-123883346 CTGTTGTGATTCAGGGAGCTGGG - Intronic
961395665 3:126587223-126587245 CTTATTTAATAAATGGTGCTGGG - Intronic
962427398 3:135283519-135283541 CTTATTTAATAAATGGTGCTGGG + Intergenic
962460606 3:135608901-135608923 CTTATTTAATAAATGGTGCTGGG + Intergenic
962656415 3:137548539-137548561 CTTATTTAATAAATGGTGCTGGG + Intergenic
962855227 3:139339216-139339238 GTTTTGTAATAAATGGCACTTGG - Intronic
963381864 3:144540708-144540730 CTTATTTAATAAATGGTGCTGGG + Intergenic
963484860 3:145922798-145922820 CTTATTTAATAAATGGTGCTGGG + Intergenic
963485742 3:145932542-145932564 CTTATTTAATAAATGGTGCTGGG + Intergenic
963853416 3:150229539-150229561 CTGCTTCAATAAATGGTGCTGGG + Intergenic
964062815 3:152544720-152544742 CTTTTTCAATAAATGGTGCTGGG + Intergenic
964152887 3:153549234-153549256 TTCTTGTGATAAATGGTGCTGGG + Intergenic
964187543 3:153964796-153964818 CTTATTTAATAAATGGTGCTGGG + Intergenic
964486666 3:157192258-157192280 CTTATTTAATAAATGGTGCTTGG - Intergenic
964635577 3:158854896-158854918 CTTATTTAATAAATGGTGCTTGG - Intergenic
964680819 3:159336576-159336598 CCTATTTAATAAATGGAGCTGGG - Intronic
964925035 3:161945230-161945252 CTTCTTTAATAAATGGTGCTGGG - Intergenic
965116914 3:164501956-164501978 CCTTTTTAATAAATGGTGCTGGG - Intergenic
965194572 3:165577099-165577121 CTTATTTAATAAATGGTGCTGGG + Intergenic
965739445 3:171858330-171858352 CCTTTTTAATAAATGGTGCTGGG + Exonic
965925007 3:173967404-173967426 CTTTTGAAATAGATGTAGCTAGG + Intronic
965988408 3:174785374-174785396 CTTATTTAATAAATGGTGCTGGG - Intronic
965999121 3:174925303-174925325 CCTTTTTAATAAATGGTGCTGGG - Intronic
966073543 3:175907925-175907947 CCTTTTTAATAAATGGTGCTGGG + Intergenic
967255592 3:187588733-187588755 CTTGTTTAATAAATGGTGCTGGG - Intergenic
967376552 3:188809913-188809935 CTTATTTAATAAATGGTGCTGGG - Intronic
967880438 3:194297610-194297632 TTGTTGAACAAAATGGAGCTAGG + Intergenic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
970054908 4:11960492-11960514 CTCTTTTAATAAATGGTGTTGGG - Intergenic
970392747 4:15632148-15632170 CCTATGTAATAAATGGTGCTGGG - Intronic
970745444 4:19289156-19289178 CTCTTTTAATACATGGAGCATGG - Intergenic
971538935 4:27791004-27791026 CTGTTTTAAGACATGAAGCTTGG - Intergenic
972013386 4:34213080-34213102 CCTATGTAATAAATGGTGCTGGG + Intergenic
972220866 4:36952542-36952564 CTTATTTAATAAATGGTGCTGGG - Intergenic
972373026 4:38444025-38444047 CTTATTTAATAAATGGTGCTGGG - Intergenic
972756015 4:42046988-42047010 CCGATTTAATAAATGGTGCTGGG + Intronic
973132353 4:46663386-46663408 CCTATGTAATAAATGGTGCTGGG - Intergenic
973137114 4:46722739-46722761 CCTATGTAATAAATGGTGCTGGG - Intergenic
973568619 4:52214384-52214406 CTTATTTAATAAATGGTGCTGGG - Intergenic
973731282 4:53824865-53824887 CTTATTTAATAAATGGTGCTGGG - Intronic
974265402 4:59580770-59580792 CTTATTTAATAAATGGTGCTGGG - Intergenic
974522112 4:62995299-62995321 CTTATTTAATAAATGGTGCTGGG - Intergenic
974548118 4:63338477-63338499 CTTATTTAATAAATGGTGCTGGG + Intergenic
975253257 4:72204210-72204232 CTTATTTAATAAATGGTGCTGGG + Intergenic
975334857 4:73164346-73164368 CTATTTTAATAAATGTAACTAGG + Intronic
975968281 4:80002318-80002340 CTTATTTAATAAATGGTGCTGGG + Intronic
976083266 4:81380000-81380022 CTATTTTAACAAATGGAGGTGGG + Intergenic
976150563 4:82087100-82087122 CTGTTGTCATGAGTGAAGCTGGG + Intergenic
976157288 4:82160203-82160225 CTTATTTAATAAATGGTGCTGGG + Intergenic
976372504 4:84305355-84305377 CTCTCTTAATAAATGGTGCTAGG + Intergenic
976392916 4:84524250-84524272 CTTGTTTAATAAATGGTGCTGGG + Intergenic
976433655 4:84992152-84992174 CCCTTTTAATAAATGGTGCTGGG + Intergenic
976655483 4:87484315-87484337 CTTATTTAATAAATGGTGCTGGG - Intronic
977707763 4:100090412-100090434 CCTATGTAATAAATGGTGCTGGG - Intergenic
978046455 4:104135152-104135174 CCTTTTTAATAAATGGTGCTGGG - Intergenic
978141461 4:105322168-105322190 CTTATTTAATAAATGGTGCTGGG + Intergenic
978142196 4:105330705-105330727 CTTATTTAATAAATGGTGCTGGG + Intergenic
978214146 4:106177561-106177583 TTTTTTTAATAAATGGTGCTGGG - Intronic
978328315 4:107584098-107584120 CCTTTTTAATAAATGGTGCTGGG + Intergenic
978364025 4:107961564-107961586 CTTATTTAATAAATGGTGCTGGG + Intergenic
978667079 4:111196589-111196611 CTTATTTAATAAATGGTGCTGGG + Intergenic
978785017 4:112599859-112599881 CTTTTTCAATAAATGGTGCTGGG + Intronic
978900062 4:113938296-113938318 CCTATGTAATAAATGGTGCTGGG + Intronic
979074331 4:116253140-116253162 CTTATTTAATAAATGGTGCTGGG - Intergenic
979215855 4:118162508-118162530 CTTATTTAATAAATGGTGCTGGG + Intronic
979663960 4:123290428-123290450 CTTTTTCAATAAATGGTGCTGGG - Intronic
980021690 4:127718215-127718237 CTTATTTAATAAATGGTGCTGGG - Exonic
980217555 4:129871974-129871996 CTTATTTAATAAATGGTGCTGGG - Intergenic
980426046 4:132629231-132629253 CCGATTTAATAAATGGTGCTGGG + Intergenic
980437409 4:132795514-132795536 CTTATTTAATAAATGGTGCTGGG + Intergenic
981200114 4:141970596-141970618 CTTATTTAATAAATGGTGCTGGG + Intergenic
981251247 4:142603852-142603874 CTGTTCTTATAAAATGAGCTAGG - Intronic
981349915 4:143717744-143717766 CCTATTTAATAAATGGAGCTGGG - Intergenic
981608952 4:146571545-146571567 CTTATTTAATAAATGGTGCTGGG - Intergenic
981745819 4:148051387-148051409 CTATTGTAATTGATGGAGCCGGG + Intronic
981958495 4:150507486-150507508 CTTATATAATAAATGGTGCTGGG + Intronic
982309322 4:153967926-153967948 CTGTTGAAGAAATTGGAGCTGGG + Intergenic
982588679 4:157275601-157275623 CCTATGTAATAAATGGTGCTGGG - Intronic
982887593 4:160801398-160801420 CCTATGTAATAAATGGTGCTGGG + Intergenic
982902924 4:161029734-161029756 CTTATTTAATAAATGGTGCTGGG + Intergenic
982906756 4:161084349-161084371 CTTATTTAATAAATGGTGCTGGG + Intergenic
983131673 4:164027508-164027530 CTTATTTAATAAATGGTGCTGGG + Intronic
983362841 4:166748394-166748416 CCTTTTTAATAAATGGTGCTGGG + Intronic
983364209 4:166765419-166765441 CCTTTTTAATAAATGGTGCTGGG - Intronic
983745893 4:171199657-171199679 CCTGTGTAATAAATGGTGCTGGG + Intergenic
984214930 4:176899341-176899363 CTTGTGAAATAGATGGAGCTAGG + Intergenic
984295144 4:177845137-177845159 CCTATGTAATAAATGGTGCTGGG - Intronic
984372843 4:178888838-178888860 CTTATTTAATAAATGGTGCTGGG + Intergenic
984676030 4:182548620-182548642 CTGTTGTAAGTATTGGAGGTGGG - Intronic
984750981 4:183273964-183273986 TTTTTGCAATAAATGGTGCTGGG - Intronic
984854416 4:184181768-184181790 CTGGTTTAATAAATGGTGCTGGG + Intronic
985242879 4:187949476-187949498 CTTATTTAATAAATGGTGCTGGG - Intergenic
985243430 4:187955459-187955481 CTTATTTAATAAATGGTGCTGGG + Intergenic
985442991 4:189998120-189998142 TTTTTGTAATAAATAGGGCTGGG - Intergenic
986943875 5:12990955-12990977 CCTGTTTAATAAATGGAGCTGGG + Intergenic
986967452 5:13291428-13291450 CCTATTTAATAAATGGAGCTGGG - Intergenic
987189938 5:15466494-15466516 CCTTTGCAATAAATGGTGCTGGG - Intergenic
987456705 5:18156159-18156181 CAGGTATAATAACTGGAGCTTGG + Intergenic
987580033 5:19778141-19778163 TTTTTGTAACAAATGGAGTTGGG - Intronic
987606201 5:20139224-20139246 CCTATGTAATAAATGGTGCTGGG + Intronic
987975837 5:25013935-25013957 CTTATTTAATAAATGGTGCTGGG + Intergenic
988036402 5:25832806-25832828 CTTATTTAATAAATGGTGCTGGG + Intergenic
988186846 5:27875118-27875140 CACTTACAATAAATGGAGCTTGG - Intergenic
988210470 5:28197388-28197410 CCTATGTAATAAATGGTGCTGGG - Intergenic
989029196 5:37100341-37100363 CCTTTTTAATAAATGGTGCTAGG - Intergenic
989078870 5:37594376-37594398 CCTTTTTAATAAATGGTGCTGGG - Intronic
989356192 5:40546081-40546103 CCTATGTAATAAATGGTGCTGGG + Intergenic
989407837 5:41081379-41081401 CTTGTTTAATAAATGGTGCTGGG - Intergenic
989423910 5:41273646-41273668 TTGTATTAATAAATGGAGATGGG - Intergenic
989809620 5:45658146-45658168 CTTATTTAATAAATGGTGCTGGG + Intronic
989820578 5:45791037-45791059 CTTATTTAATAAATGGTGCTGGG + Intergenic
989835282 5:45980952-45980974 CTTATTTAATAAATGGTGCTGGG - Intergenic
989994535 5:50812826-50812848 CTTATTTAATAAATGGTGCTGGG - Intronic
990223849 5:53627113-53627135 CCTTTTTAATAAATGGTGCTGGG - Intronic
990648027 5:57866594-57866616 CTTATTTAATAAATGGTGCTGGG - Intergenic
990912357 5:60865188-60865210 CTTATTTAATAAATGGTGCTGGG + Intergenic
990930981 5:61091927-61091949 CTTATGCAATAAATGGTGCTGGG - Intronic
991110292 5:62892110-62892132 CCTATGTAATAAATGGTGCTAGG - Intergenic
992032160 5:72732496-72732518 CCTATGTAATAAATGGTGCTGGG + Intergenic
993200405 5:84808788-84808810 CCTATGTAATAAATGGTGCTGGG - Intergenic
993240737 5:85381085-85381107 CTTATTTAATAAATGGTGCTGGG - Intergenic
993632732 5:90306491-90306513 CTTTTGCAATAAATGGAAGTAGG - Intergenic
994298446 5:98118333-98118355 CCTATGTAATAAATGGTGCTGGG + Intergenic
994308357 5:98235909-98235931 CCTATGTAATAAATGGTGCTGGG - Intergenic
994308612 5:98238985-98239007 CCTATGTAATAAATGGTGCTGGG + Intergenic
994390100 5:99182148-99182170 CTTATTTAATAAATGGTGCTGGG - Intergenic
994442681 5:99830187-99830209 CTTATTTAATAAATGGTGCTGGG - Intergenic
994990879 5:106995517-106995539 CTTATTTAATAAATGGTGCTGGG - Intergenic
995343486 5:111086114-111086136 CTTATTTAATAAATGGTGCTGGG - Intergenic
995810674 5:116103881-116103903 CCTATGTAATAAATGGTGCTGGG - Intronic
996059933 5:119021991-119022013 CAGTTGCAAGAAATTGAGCTAGG + Intergenic
996246970 5:121276054-121276076 CTTATTTAATAAATGGTGCTGGG + Intergenic
996791883 5:127302165-127302187 CTGTTGTAAATAATGCTGCTAGG - Intronic
996842763 5:127865975-127865997 CTGTTGTAACACAGGGAGCACGG - Intergenic
997670278 5:135665654-135665676 CTTATTTAATAAATGGTGCTGGG - Intergenic
998776153 5:145605405-145605427 CTTATTTAATAAATGGTGCTGGG - Intronic
999557754 5:152763893-152763915 CCTATGTAATAAATGGTGCTTGG - Intergenic
999867324 5:155715176-155715198 CTTATTTAATAAATGGTGCTGGG - Intergenic
999964173 5:156790373-156790395 CTTATTTAATAAATGGTGCTGGG + Intergenic
1000250632 5:159491637-159491659 CTGTGGTATAAGATGGAGCTGGG - Intergenic
1000377553 5:160597303-160597325 CCTTTTTAATAAATGGTGCTGGG + Intronic
1000384601 5:160662554-160662576 CCTTTTTAATAAATGGTGCTGGG + Intronic
1000387652 5:160690115-160690137 CTTATTTAATAAATGGTGCTGGG + Intronic
1000490184 5:161903273-161903295 CTTATTTAATAAATGGTGCTGGG - Intergenic
1000536047 5:162479421-162479443 CCTTTATAATAAATGGTGCTGGG + Intergenic
1000655414 5:163872865-163872887 CTTATTTAATAAATGGTGCTGGG + Intergenic
1002825781 6:772785-772807 CTTATTTAATAAATGGTGCTGGG - Intergenic
1003585600 6:7386369-7386391 ATTTTTTAATAAAGGGAGCTAGG + Intronic
1003745872 6:9001417-9001439 CTTTGATAATAAATGGTGCTAGG - Intergenic
1003782854 6:9448629-9448651 CTTATTTAATAAATGGTGCTGGG + Intergenic
1004032318 6:11882768-11882790 CTTATTTAATAAATGGTGCTGGG + Intergenic
1005242500 6:23847635-23847657 CCTATGTAATAAATGGTGCTGGG + Intergenic
1005323219 6:24675957-24675979 CCCTTTTAATAAATGGTGCTGGG - Intronic
1005706710 6:28461938-28461960 CTGTGTTAATATGTGGAGCTTGG - Intergenic
1006617148 6:35337799-35337821 CTTATTTAATAAATGGTGCTGGG - Intergenic
1008233124 6:49009739-49009761 CCTATGTAATAAATGGTGCTGGG - Intergenic
1008293614 6:49750576-49750598 CTTATTTAATAAATGGTGCTGGG - Intergenic
1008357487 6:50571579-50571601 CTGATTTAATAAATAGTGCTGGG - Intergenic
1008861703 6:56156725-56156747 CTGTTGGAACGAAAGGAGCTAGG - Intronic
1009191728 6:60637557-60637579 CTCTTCCAATAAATGGTGCTGGG + Intergenic
1009247800 6:61261150-61261172 CAGATTTAATAAATGGTGCTGGG - Intergenic
1009547433 6:65037989-65038011 TTGTTGAAATTAATGAAGCTAGG - Intronic
1009605898 6:65866756-65866778 CCTATTTAATAAATGGAGCTGGG + Intergenic
1009660870 6:66609550-66609572 CTTATTTAATAAATGGTGCTGGG - Intergenic
1009799608 6:68518726-68518748 CTTATTTAATAAATGGTGCTGGG - Intergenic
1009856412 6:69270768-69270790 GTGTTGTATTAAATGAACCTGGG - Intronic
1010307205 6:74338983-74339005 CTTATTTAATAAATGGTGCTGGG - Intergenic
1010333202 6:74648331-74648353 CTTTTTCAATAAATGGTGCTAGG + Intergenic
1010464483 6:76150941-76150963 CTTATTTAATAAATGGTGCTGGG - Intergenic
1010475431 6:76281177-76281199 CTTATTTAATAAATGGTGCTGGG - Intergenic
1010637356 6:78277450-78277472 CTTATTTAATAAATGGTGCTGGG - Intergenic
1010684645 6:78839016-78839038 CTTATTTAATAAATGGTGCTGGG + Intergenic
1010827681 6:80493508-80493530 CTTATTTAATAAATGGTGCTGGG - Intergenic
1010959143 6:82125414-82125436 CTTATTTAATAAATGGTGCTGGG - Intergenic
1011082072 6:83500547-83500569 CTTATTTAATAAATGGTGCTGGG + Intergenic
1011145164 6:84206478-84206500 CTTATTTAATAAATGGTGCTGGG + Intronic
1011147842 6:84238404-84238426 CTTATTTAATAAATGGTGCTGGG + Intergenic
1011266196 6:85521974-85521996 CTGTTTCAATAAATAGTGCTGGG - Intronic
1011667557 6:89649357-89649379 ATGTGTTAATAAATGGAGCTGGG + Intronic
1011767591 6:90639744-90639766 CTGTTGTTAGAATTGGAACTTGG - Intergenic
1012621420 6:101348873-101348895 CTCTTGTCATAAATGCATCTTGG + Intergenic
1012724682 6:102795533-102795555 CGCTTTTAATAAATGGTGCTGGG - Intergenic
1012743282 6:103048431-103048453 CTGTAGTAATAAAGGTAGGTTGG - Intergenic
1012848060 6:104414472-104414494 CTGTTGTCTGAAATGGAGGTGGG + Intergenic
1013397623 6:109758366-109758388 CTTATTTAATAAATGGTGCTGGG + Intronic
1013683518 6:112551834-112551856 CCTGTGTAATAAATGGTGCTGGG - Intergenic
1013813723 6:114073052-114073074 CTTATTTAATAAATGGTGCTGGG + Intronic
1014059545 6:117054781-117054803 CTTATTTAATAAATGGTGCTGGG + Intergenic
1014224756 6:118835081-118835103 CTCATGTAATAAATGGTGTTGGG - Intronic
1014347938 6:120299070-120299092 CTGTTTCAATATATGGTGCTGGG + Intergenic
1014565210 6:122940589-122940611 CTTATTTAATAAATGGTGCTGGG - Intergenic
1015312721 6:131782927-131782949 CTGTTGTAATAATGGAAGCCAGG + Intergenic
1018160048 6:161031199-161031221 GTTTTGTAATAAATGCAGATCGG + Intronic
1018580622 6:165305231-165305253 CCGATTTAATAAATGGTGCTGGG + Intronic
1019265266 7:112294-112316 CTGTTTCAATAAATGGTGCCAGG - Intergenic
1020539412 7:9441286-9441308 CCTTTTTAATAAATGGTGCTGGG + Intergenic
1020619458 7:10500402-10500424 CTGTTGTCATAAAATGAGTTAGG - Intergenic
1022229723 7:28402582-28402604 CTTATTTAATAAATGGTGCTGGG + Intronic
1022554748 7:31281597-31281619 CCTATTTAATAAATGGAGCTGGG + Intergenic
1022631203 7:32086763-32086785 CCGATTTAATAAATGGTGCTGGG + Intronic
1022792247 7:33700725-33700747 CTGTTGAAAGAAATGGGGCGGGG - Intergenic
1024744949 7:52395360-52395382 CTTTTTCAATAAATGGTGCTGGG - Intergenic
1024895936 7:54262245-54262267 CTTTTTCAATAAATGGAGCTGGG - Intergenic
1024909842 7:54434599-54434621 CTGATTTAAGAAATGGAGATTGG + Intergenic
1025545481 7:62160685-62160707 CTTATTTAATAAATGGTGCTGGG + Intergenic
1026333732 7:69375988-69376010 CTTATTTAATAAATGGTGCTGGG - Intergenic
1027488776 7:78795896-78795918 CTGTTTAAATAAATGGTGCCAGG + Intronic
1027897798 7:84067180-84067202 CTTATTTAATAAATGGTGCTGGG + Intronic
1028081744 7:86585892-86585914 CTTATTTAATAAATGGTGCTGGG - Intergenic
1028307017 7:89278583-89278605 CTTATTTAATAAATGGTGCTGGG - Intronic
1028489038 7:91390711-91390733 CTTATTTAATAAATGGTGCTGGG - Intergenic
1028497427 7:91477904-91477926 CTTATTTAATAAATGGTGCTGGG - Intergenic
1028837188 7:95387891-95387913 CCTATGTAATAAATGGTGCTGGG + Intronic
1029835575 7:103306206-103306228 ATTTTATAATAAATGAAGCTAGG - Intronic
1030590041 7:111469632-111469654 CTTATTTAATAAATGGTGCTGGG + Intronic
1031179139 7:118392882-118392904 CCTATTTAATAAATGGAGCTGGG + Intergenic
1031247889 7:119340398-119340420 CCTATTTAATAAATGGAGCTGGG + Intergenic
1031259732 7:119503373-119503395 CTTATTTAATAAATGGTGCTGGG - Intergenic
1031313109 7:120224283-120224305 CTGTTTTAATATATGGACTTAGG - Intergenic
1031831451 7:126631790-126631812 CCGATTTAATAAATGGTGCTGGG + Intronic
1032860506 7:135873952-135873974 CTCATTTAATAAATGGTGCTGGG - Intergenic
1033522769 7:142178586-142178608 CTTTATTAATAAATGGTGCTGGG - Intronic
1033829657 7:145236777-145236799 CTTATTTAATAAATGGTGCTGGG - Intergenic
1033838315 7:145342629-145342651 CTTATTTAATAAATGGTGCTGGG + Intergenic
1034581185 7:152043915-152043937 CTGTGGTAAGAAGGGGAGCTTGG - Intronic
1035385527 7:158469926-158469948 CTGTTGCCATAACAGGAGCTGGG + Intronic
1035956732 8:4088745-4088767 CTGTTGGAATAAATGGTGGTGGG - Intronic
1036462859 8:8969526-8969548 CTGTTCTAAAAGATGGAACTTGG + Intergenic
1036586046 8:10124515-10124537 CTGGTGCCATAATTGGAGCTAGG + Intronic
1037798971 8:22021151-22021173 CTTCTTTAATAAATGGTGCTGGG + Intergenic
1039204128 8:35130790-35130812 CTTTTTCAAAAAATGGAGCTGGG - Intergenic
1040070662 8:43184869-43184891 CTTATTTAATAAATGGTGCTGGG - Intronic
1040326814 8:46349843-46349865 CTTATTTAATAAATGGCGCTGGG - Intergenic
1040347219 8:46516549-46516571 CCTATGTAATAAATGGTGCTGGG - Intergenic
1040364422 8:46700498-46700520 CTTATTTAATAAATGGTGCTGGG - Intergenic
1040438006 8:47411887-47411909 CTTATTTAATAAATGGTGCTGGG - Intronic
1041571330 8:59340055-59340077 TTGTTGTAATAAATGGTTTTAGG + Intergenic
1041795496 8:61743238-61743260 ATCTTTTAATAAATGAAGCTGGG + Intergenic
1042023796 8:64401085-64401107 CCTATGTAATAAATGGTGCTGGG - Intergenic
1042073323 8:64960461-64960483 CCTATTTAATAAATGGAGCTGGG + Intergenic
1042174470 8:66025660-66025682 CTTATTTAATAAATGGTGCTGGG - Intronic
1042177587 8:66052309-66052331 CTTTTTTAATAAAAGGAGTTTGG + Intronic
1042332078 8:67591118-67591140 CTTATTTAATAAATGGTGCTGGG - Intronic
1042338378 8:67652972-67652994 CTTATTTAATAAATGGTGCTGGG - Intronic
1043189696 8:77202930-77202952 CCTTTTTAATAAATGGTGCTGGG - Intergenic
1043279854 8:78449752-78449774 CTTATTTAATAAATGGTGCTGGG + Intergenic
1043378775 8:79680410-79680432 CTTATTTAATAAATGGTGCTGGG + Intergenic
1043938445 8:86169710-86169732 CTTATTTAATAAATGGTGCTGGG - Intergenic
1043981703 8:86649557-86649579 CTTGTTTAATAAATGGTGCTGGG + Intronic
1044196152 8:89378820-89378842 CTTATTTAATAAATGGTGCTGGG + Intergenic
1044315399 8:90744814-90744836 CCCTATTAATAAATGGAGCTGGG - Intronic
1045002122 8:97887554-97887576 CTCTTGTAATAAATGTATGTGGG + Intronic
1045163263 8:99573532-99573554 CCTTTTTAATAAATGGTGCTGGG - Intronic
1045164484 8:99588054-99588076 CCTTTTTAATAAATGGTGCTGGG - Intronic
1045633792 8:104159128-104159150 CTTATTTAATAAATGGTGCTGGG - Intronic
1045715463 8:105038427-105038449 CTTATTTAATAAATGGTGCTGGG + Intronic
1045716898 8:105057437-105057459 CTTATTTAATAAATGGTGCTGGG + Intronic
1046667673 8:117022635-117022657 CCTTTTTAATAAATGGTGCTGGG + Intronic
1046747219 8:117889098-117889120 CAGTTGTGATAGCTGGAGCTGGG + Intronic
1046985766 8:120386804-120386826 CTTATTTAATAAATGGTGCTGGG - Intronic
1047474739 8:125215767-125215789 CCGATTTAATAAATGGTGCTGGG - Intronic
1048122338 8:131595929-131595951 CCTATTTAATAAATGGAGCTGGG - Intergenic
1048402994 8:134089285-134089307 CCGATTTAATAAATGGTGCTGGG - Intergenic
1048412585 8:134190821-134190843 CCGATTTAATAAATGGTGCTGGG - Intergenic
1048796821 8:138158208-138158230 CTTTTTAAATAAATGGTGCTGGG + Intronic
1049141462 8:140958959-140958981 CTTTTTCAATAAATGGTGCTGGG - Intronic
1050039207 9:1471096-1471118 CTGTGTATATAAATGGAGCTGGG + Intergenic
1050387447 9:5105821-5105843 CTTATTTAATAAATGGTGCTGGG + Intronic
1051645772 9:19266735-19266757 CTTATTTAATAAATGGTGCTGGG + Intronic
1051725045 9:20080385-20080407 CTTATTTAATAAATGGTGCTGGG + Intergenic
1051822627 9:21185407-21185429 CTTATTTAATAAATGGTGCTGGG - Intergenic
1052087170 9:24282248-24282270 CTTATTTAATAAATGGTGCTGGG + Intergenic
1052110450 9:24575771-24575793 CCTTTTTAATAAATGGTGCTGGG - Intergenic
1052117227 9:24664065-24664087 CTTATTTAATAAATGGTGCTGGG - Intergenic
1052176313 9:25467256-25467278 CTTATTTAATAAATGGTGCTGGG - Intergenic
1052200186 9:25768782-25768804 CTTATTTAATAAATGGTGCTGGG + Intergenic
1052315573 9:27113287-27113309 CTCTCTTAATAAATGAAGCTTGG + Intronic
1052469570 9:28877484-28877506 CCTATTTAATAAATGGAGCTGGG - Intergenic
1052627810 9:31000167-31000189 CCGATTTAATAAATGGTGCTGGG - Intergenic
1053305902 9:36984749-36984771 CTGTTGGAAAAAATGAGGCTGGG - Intronic
1055983457 9:82030741-82030763 CTCTTGTAAGAAATGGAATTAGG - Intergenic
1056450666 9:86713748-86713770 CTGATCTTATAATTGGAGCTTGG - Intergenic
1056807501 9:89740318-89740340 ATGATGGAAAAAATGGAGCTGGG + Intergenic
1056885479 9:90439355-90439377 CTTATTTAATAAATGGTGCTGGG - Intergenic
1058652196 9:107186732-107186754 CTTCTTTAATAAATGGTGCTAGG + Intergenic
1059126969 9:111698425-111698447 CTTATTTAATAAATGGTGCTGGG - Intronic
1059131181 9:111751077-111751099 CTTATTTAATAAATGGTGCTGGG - Intronic
1059297757 9:113287242-113287264 TTTCTGGAATAAATGGAGCTAGG - Intronic
1059411622 9:114136157-114136179 CTGTTGTCTTAAGTGGAGTTTGG - Intergenic
1059787896 9:117606512-117606534 CTGTTTTAATAAACAGAGGTGGG - Intergenic
1059837121 9:118168524-118168546 GTGTTTTAGTAAATGGTGCTGGG - Intergenic
1062062999 9:134507485-134507507 CCTTTTTAATAAATGGTGCTGGG - Intergenic
1202804082 9_KI270720v1_random:34102-34124 CTTATTTAATAAATGGTGCTGGG + Intergenic
1186743570 X:12542997-12543019 CCTTTTTAATAAATGGTGCTGGG + Intronic
1187114994 X:16340606-16340628 CCTATGTAATAAATGGTGCTGGG - Intergenic
1187647103 X:21359159-21359181 CTTATTTAATAAATGGTGCTGGG + Intergenic
1188075887 X:25774707-25774729 CTTATTTAATAAATGGTGCTGGG + Intergenic
1188198135 X:27264284-27264306 CTTATTTAATAAATGGTGCTGGG + Intergenic
1188935570 X:36171530-36171552 CTTATTTAATAAATGGTGCTGGG - Intergenic
1188940369 X:36230843-36230865 CTTATTTAATAAATGGTGCTGGG - Intronic
1189467233 X:41286480-41286502 CTGTTGTAAATAAAGGAGCTGGG - Intergenic
1190531515 X:51383168-51383190 CTGATTCAATAAATGGTGCTTGG + Intergenic
1191023032 X:55883208-55883230 CTTATTTAATAAATGGTGCTGGG + Intergenic
1191032356 X:55988434-55988456 CTTATTTAATAAATGGTGCTGGG - Intergenic
1191037997 X:56048500-56048522 CTTATTTAATAAATGGTGCTGGG - Intergenic
1191042711 X:56102183-56102205 CTTATTTAATAAATGGTGCTGGG - Intergenic
1191076007 X:56454115-56454137 CTTATTTAATAAATGGTGCTGGG - Intergenic
1191131799 X:57021710-57021732 CTTATTTAATAAATGGTGCTGGG - Intergenic
1191185694 X:57608518-57608540 GTTTTTTAATAAATGGGGCTGGG - Intergenic
1191579732 X:62747090-62747112 CTTATTTAATAAATGGTGCTGGG + Intergenic
1191763725 X:64672434-64672456 CTTTTTCAATAAATGGTGCTAGG + Intergenic
1191765227 X:64691197-64691219 CTTATTTAATAAATGGTGCTGGG - Intergenic
1191792832 X:64988951-64988973 CTTATTTAATAAATGGTGCTGGG - Intronic
1191931513 X:66378428-66378450 CTTATTTAATAAATGGTGCTGGG - Intergenic
1191939135 X:66458739-66458761 CCTTTTTAATAAATGGTGCTGGG + Intergenic
1192097641 X:68229671-68229693 CCTTTTTAATAAATGGTGCTGGG + Intronic
1192188167 X:68970676-68970698 CTGTTCTCATAAAATGAGCTTGG - Intergenic
1192475913 X:71442894-71442916 CTAATTTAATAAATGGTGCTGGG - Intronic
1192684168 X:73286252-73286274 CCTATGTAATAAATGGTGCTGGG + Intergenic
1192686889 X:73316541-73316563 CCTATGTAATAAATGGTGCTGGG + Intergenic
1192693902 X:73394271-73394293 CCTTTTTAATAAATGGTGCTGGG - Intergenic
1192701334 X:73477481-73477503 CTTATTTAATAAATGGTGCTGGG - Intergenic
1193089148 X:77475524-77475546 CCTTTTTAATAAATGGTGCTGGG + Intergenic
1193282962 X:79676853-79676875 TTGGGGTGATAAATGGAGCTAGG + Intergenic
1193572060 X:83156071-83156093 CTTATTTAATAAATGGTGCTGGG + Intergenic
1193733435 X:85128879-85128901 CCTTTTTAATAAATGGTGCTGGG - Intergenic
1193736745 X:85166035-85166057 CCTATGTAATAAATGGTGCTGGG + Intergenic
1193746185 X:85284564-85284586 CCTTTTTAATAAATGGTGCTGGG + Intronic
1193812496 X:86068166-86068188 CTTGTGTAATAAATGGTGCTGGG + Intergenic
1193832273 X:86304130-86304152 CTGCTTCAATAAATGGTGCTAGG + Intronic
1193913210 X:87330430-87330452 CCTATGTAATAAATGGTGCTGGG + Intergenic
1193991474 X:88313245-88313267 CTTATGTAATAAATGGTGCTGGG + Intergenic
1194078746 X:89431710-89431732 CCTATTTAATAAATGGAGCTGGG - Intergenic
1194190872 X:90835755-90835777 CTTTTTTAATAAATGGTGCTGGG + Intergenic
1194274259 X:91859690-91859712 CTTTTTTAATAAATGGTGCTGGG - Intronic
1194625223 X:96219423-96219445 CTTATTTAATAAATGGTGCTGGG + Intergenic
1194630260 X:96274274-96274296 CTTATTTAATAAATGGTGCTGGG + Intergenic
1194636105 X:96346597-96346619 CCCTTTTAATAAATGGTGCTGGG - Intergenic
1194902216 X:99526400-99526422 CCGATTTAATAAATGGTGCTGGG + Intergenic
1194909844 X:99628492-99628514 CCTATGTAATAAATGGTGCTCGG + Intergenic
1195507467 X:105674401-105674423 CTCATTTAATAAATGGTGCTGGG - Intronic
1195508709 X:105688981-105689003 CCTGTGTAATAAATGGTGCTGGG + Intronic
1195523767 X:105861596-105861618 GTCTTTTAACAAATGGAGCTGGG - Intronic
1195820451 X:108939630-108939652 CTTATTTAATAAATGGTGCTAGG - Intergenic
1196140117 X:112252310-112252332 CTGCTGTAATAACATGAGCTTGG + Intergenic
1196168381 X:112560317-112560339 CCGATATAATAAATGGTGCTGGG + Intergenic
1196356157 X:114795597-114795619 CTTATTTAATAAATGGTGCTGGG - Intronic
1196472807 X:116048138-116048160 CTTATTTAATAAATGGTGCTGGG - Intergenic
1196562627 X:117168735-117168757 CCTATGTAATAAATGGTGCTGGG + Intergenic
1196711313 X:118766371-118766393 CTTTTTTAATAAATGGTGCTGGG - Intronic
1196945171 X:120817057-120817079 CTTATTTAATAAATGGTGCTGGG + Intergenic
1196993950 X:121360145-121360167 CTTATTTAATAAATGGTGCTGGG + Intergenic
1197312241 X:124918848-124918870 ATTTTTTAAAAAATGGAGCTAGG + Intronic
1197527995 X:127586201-127586223 CTTATTTAATAAATGGTGCTGGG + Intergenic
1197569894 X:128136540-128136562 CTTATTTAATAAATGGTGCTGGG + Intergenic
1197840599 X:130741995-130742017 CTTTTGAAATAAATGAAGCCTGG + Intronic
1198153261 X:133932075-133932097 CTGTTTTAATAAAGAGAGGTGGG - Intronic
1198273062 X:135073677-135073699 CCGATTTAATAAATGGTGCTGGG - Intergenic
1198371627 X:135995224-135995246 TTGTTGTGATAAATGGAGACTGG + Intronic
1198818504 X:140618919-140618941 CCTTTTTAATAAATGGTGCTGGG - Intergenic
1199022061 X:142892704-142892726 CCTATTTAATAAATGGAGCTGGG - Intergenic
1199026938 X:142950704-142950726 CTTATTTAATAAATGGTGCTGGG - Intergenic
1199080851 X:143575425-143575447 CTTATTTAATAAATGGTGCTGGG - Intergenic
1199821098 X:151447511-151447533 CTTTTTCAATAAATGGTGCTGGG + Intergenic
1200431366 Y:3087048-3087070 CCTATTTAATAAATGGAGCTGGG - Intergenic
1200537531 Y:4418175-4418197 CTTTTTTAATAAATGGTGCTGGG + Intergenic
1200591495 Y:5081097-5081119 CCTTTTTAATAAATGGTGCTGGG - Intronic
1200868279 Y:8068776-8068798 CTGTTGAAATAATTGGAGTCAGG + Intergenic
1201068171 Y:10119417-10119439 TTTTTGTAATAAATAGGGCTGGG + Intergenic
1201314005 Y:12625249-12625271 CTTATTTAATAAATGGTGCTGGG - Intergenic
1201495297 Y:14586409-14586431 GGGTTGTGAAAAATGGAGCTGGG + Intronic
1201572622 Y:15430816-15430838 CCTTTTTAATAAATGGTGCTGGG + Intergenic
1201780265 Y:17713249-17713271 CCCTAGTAATAAATGGTGCTGGG + Intergenic
1201787875 Y:17805556-17805578 CTTATTTAATAAATGGTGCTGGG - Intergenic
1201795688 Y:17894450-17894472 CTTATTTAATAAATGGTGCTGGG + Intergenic
1201805867 Y:18011535-18011557 CTTATTTAATAAATGGTGCTGGG - Intergenic
1201813678 Y:18100432-18100454 CTTATTTAATAAATGGTGCTGGG + Intergenic
1201821289 Y:18192743-18192765 CCCTAGTAATAAATGGTGCTGGG - Intergenic
1201913991 Y:19162896-19162918 CTTATTTAATAAATGGTGCTGGG + Intergenic
1202065834 Y:20939033-20939055 CCTTTTTAATAAATGGTGCTGGG - Intergenic
1202344829 Y:23910524-23910546 CCTATGTAATAAATGGTGCTGGG + Intergenic
1202357111 Y:24063542-24063564 CTTATTTAATAAATGGTGCTGGG + Intergenic
1202513666 Y:25606572-25606594 CTTATTTAATAAATGGTGCTGGG - Intergenic
1202525941 Y:25759560-25759582 CCTATGTAATAAATGGTGCTGGG - Intergenic