ID: 1091957358

View in Genome Browser
Species Human (GRCh38)
Location 12:4657992-4658014
Sequence TGTCAGCTACATCTCCTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091957358 Original CRISPR TGTCAGCTACATCTCCTCAG GGG (reversed) Intronic
903769561 1:25755190-25755212 TGTGAGCTGCACCTCCTCACTGG + Intronic
903785629 1:25859360-25859382 TGCCGGCTTCGTCTCCTCAGCGG - Exonic
904993274 1:34611094-34611116 TTTCAGCTGCATCTCCTCTTGGG - Intergenic
909006334 1:70280672-70280694 TGTCAACTATATAACCTCAGAGG + Intronic
910454493 1:87382885-87382907 TATCAGCACCTTCTCCTCAGAGG - Intergenic
919965218 1:202516440-202516462 AGTCAGCAACATCTCCTTACTGG - Intronic
923242462 1:232099005-232099027 TCTCAGCTACAGCACTTCAGAGG - Intergenic
923299431 1:232628237-232628259 TGTTAGGGACATCTCCCCAGAGG - Intergenic
924434099 1:244023337-244023359 GGTCAGCCACAGCTCCTCCGGGG - Intergenic
1065647367 10:27849568-27849590 AGTCAGCTGAATCACCTCAGAGG + Intronic
1068422886 10:56820051-56820073 TGTCAGTTACAACTCATCATTGG - Intergenic
1068594795 10:58891062-58891084 TACCAGCAACAGCTCCTCAGAGG - Intergenic
1069848515 10:71390131-71390153 TGTCAGCCACCACCCCTCAGTGG - Intergenic
1072627748 10:97124476-97124498 TGCCAGCTGGATCTCCTCTGCGG + Intronic
1076259087 10:129051336-129051358 GGCCAGCTACCTCTCCTCACAGG - Intergenic
1081808496 11:45902597-45902619 GGTCAGGTAGATCTCCTCAGTGG - Exonic
1082992242 11:59217399-59217421 TGTCAGCTTCTTCCCCTCAGAGG + Intergenic
1083855925 11:65393094-65393116 GGTCAGCTGGAGCTCCTCAGAGG + Intronic
1090535112 11:127632494-127632516 AGTCAGCTGTATCTCCTCATGGG + Intergenic
1090662433 11:128891585-128891607 TTCCAGCTACAGCTCCTCCGTGG + Exonic
1091957358 12:4657992-4658014 TGTCAGCTACATCTCCTCAGGGG - Intronic
1092887186 12:12935098-12935120 CGTCAGGTGCATCTTCTCAGAGG + Intergenic
1094386589 12:29901005-29901027 TGTCAACTACATCTTCTCGGTGG + Intergenic
1096739010 12:53677904-53677926 TGTCAGCTTCACATCCTCAGTGG + Intergenic
1100861532 12:98811702-98811724 TGTCAGCTACCTCTCCACATAGG - Intronic
1102613356 12:114131878-114131900 TGTCAGCCACCTCTCCTCATGGG - Intergenic
1102897045 12:116606750-116606772 TGTAAGCTAAGTCTCCACAGTGG + Intergenic
1104892092 12:132144951-132144973 TGTCATGACCATCTCCTCAGAGG - Exonic
1105639092 13:22244103-22244125 CGGCAGCCACATCCCCTCAGGGG - Intergenic
1111170302 13:84518489-84518511 TTTAAGGTACATCACCTCAGGGG - Intergenic
1113158607 13:107353656-107353678 TGTCAGCCACATGTCCTCATTGG - Intronic
1113255047 13:108496493-108496515 TGTCAGCTCCATTGTCTCAGAGG + Intergenic
1114808845 14:25871689-25871711 TGTCAACTACATTTCCTCACAGG + Intergenic
1115623078 14:35160158-35160180 TGTCTTGTACATCTCATCAGTGG - Intronic
1115903731 14:38183936-38183958 TGTAAGCTAGATCTCTTGAGGGG + Intergenic
1119948841 14:78723517-78723539 TCTCAGCTACATCTGCTTAATGG - Intronic
1121918237 14:97855617-97855639 TGACAGCTACATCTGGCCAGTGG - Intergenic
1121918471 14:97857867-97857889 TGCCAGCTTCATCTCCTCCTGGG - Intergenic
1125909279 15:43421619-43421641 TGTTACCTACATTTTCTCAGGGG + Intronic
1128545659 15:68566003-68566025 TGTCAGCTGCCTCTCCACAGAGG - Intergenic
1131254472 15:90852933-90852955 CCTCAGCCACAGCTCCTCAGTGG + Intergenic
1134039449 16:11057222-11057244 TCACAGCTACATGGCCTCAGTGG + Intronic
1134668762 16:16038980-16039002 AGTCAGTTTCATCTGCTCAGTGG - Intronic
1138299855 16:55916893-55916915 AGTCAGTGACATCTTCTCAGAGG + Intronic
1141289358 16:82703476-82703498 TGTCAAATACATCTCCAAAGGGG - Intronic
1141827208 16:86488998-86489020 TGGCAGGTACATCCCCTCAATGG - Intergenic
1143600225 17:7940304-7940326 TGTCTGCCACAACTCCTGAGAGG - Intronic
1144943804 17:18959642-18959664 GCCCATCTACATCTCCTCAGAGG + Exonic
1145986220 17:29048747-29048769 TGTCAGCCACATCCCCTCCCTGG + Intronic
1146973122 17:37088740-37088762 TTTCAGCTACTGCTCCCCAGGGG - Intronic
1151504310 17:74516537-74516559 TCTCAGCTCCATCTCCTCCAGGG - Intergenic
1152684779 17:81688595-81688617 TGTCAGCCCCATCTGCTCAGAGG + Intronic
1153229220 18:2920644-2920666 GATCAGCTACATCTCCTCTGTGG - Intronic
1154948143 18:21182716-21182738 TGTCAGAAATATCTCCTCTGTGG - Intergenic
1156624044 18:38886996-38887018 TGTCAGCCTCATCTCCACAAGGG - Intergenic
1158533849 18:58289579-58289601 AGTCAGCTACACATGCTCAGGGG + Intronic
1160672570 19:373310-373332 TCTCAGCTCTAGCTCCTCAGGGG + Intronic
930664479 2:54088495-54088517 TGCCCTCTCCATCTCCTCAGCGG + Intronic
930726557 2:54687322-54687344 TGCCAGCTACAGCTGCTAAGAGG - Intergenic
932950079 2:76282361-76282383 TGTCAGCTACATCTCCATAATGG - Intergenic
933532879 2:83532876-83532898 TGTTAGCTTGATCTCCTGAGAGG + Intergenic
933572999 2:84035752-84035774 TGTCAGTCTCATCTGCTCAGAGG - Intergenic
935192097 2:100786487-100786509 TGCCAGCGACATCTCCTAACTGG + Intergenic
942996830 2:182272540-182272562 GGTCAAATGCATCTCCTCAGTGG - Intronic
945017870 2:205538705-205538727 TGTAAGCCAGATCTGCTCAGGGG + Intronic
945397652 2:209339747-209339769 TCTCAGCAACAACTACTCAGAGG + Intergenic
947111681 2:226725354-226725376 TTTCAGCTACGCCTCCTGAGCGG - Intergenic
948598470 2:239095391-239095413 TGTTAGATACAGCCCCTCAGGGG - Intronic
948871063 2:240798448-240798470 TGTCTCCTGCTTCTCCTCAGTGG - Intronic
1170394396 20:15910253-15910275 TGTGAGCTTCAAGTCCTCAGTGG + Intronic
1170553026 20:17493443-17493465 TGTCTGCCAGAGCTCCTCAGTGG + Intergenic
1175142345 20:56870357-56870379 TGTCAGCTACTTCTTCTTATTGG - Intergenic
1180763202 22:18224098-18224120 TTTCAGCAACACCTCCGCAGAGG + Intergenic
1180772444 22:18400449-18400471 TTTCAGCAACACCTCCGCAGAGG - Intergenic
1181217896 22:21345194-21345216 TTTCAGCAACACCTCCGCAGAGG + Intergenic
1181546371 22:23604760-23604782 TGTCAGCTCCATCAGCTCAGGGG + Intergenic
1182039470 22:27225185-27225207 TGTCCGTTGCATCTCTTCAGGGG + Intergenic
1182541740 22:31046824-31046846 GGTCAGCTGCATTTCCCCAGAGG + Intergenic
1182848007 22:33447368-33447390 GGTCAGCAACATCTTCTGAGGGG + Intronic
1183732473 22:39626383-39626405 TGTCAGGGACGTCTTCTCAGGGG + Intronic
1184200141 22:42962890-42962912 TGTCAGCCACATCTCACTAGTGG + Intronic
1184330387 22:43823527-43823549 GCTCAGCACCATCTCCTCAGAGG + Intergenic
1184814702 22:46860752-46860774 TGGCAGCAGGATCTCCTCAGTGG - Intronic
1185349331 22:50326486-50326508 TGACACCTTCATCCCCTCAGTGG - Intronic
949442582 3:4098229-4098251 TCTCAGAGACATCTCTTCAGAGG + Intronic
949487180 3:4551043-4551065 CTTCAGCTACATCTGCTCTGTGG - Intronic
950906997 3:16547751-16547773 GGTCAGTGACATCTCCTCTGTGG - Intergenic
951688576 3:25371919-25371941 CGTCAAATCCATCTCCTCAGTGG - Intronic
951980789 3:28564190-28564212 CAGCAGCTACATCTCCTCTGTGG - Intergenic
956774170 3:72551131-72551153 TGTCTGCTGCATCTTCTTAGGGG + Intergenic
961455530 3:127022092-127022114 TGTCAGCGACTTCTCCACATTGG - Exonic
961763605 3:129190466-129190488 TGCCAGCCACATCTCATAAGGGG + Intergenic
962243875 3:133775361-133775383 AGTCAGTTCCATCTCCCCAGCGG + Intronic
962483034 3:135814383-135814405 TGTCCTATACATATCCTCAGAGG + Intergenic
965485785 3:169276628-169276650 TGTCTGCTCCCTCTCCTCAAAGG + Intronic
970702468 4:18758573-18758595 TTGCAGCTACATCTCCTCTACGG - Intergenic
980457282 4:133061200-133061222 TTTCAACAACATCTCCTCAAAGG + Intergenic
983925639 4:173398928-173398950 TGCCTGCATCATCTCCTCAGAGG + Intronic
985543233 5:496361-496383 CGTGAGCCACATCTCCTGAGGGG + Intronic
985561743 5:590961-590983 TGGCAGGTACCCCTCCTCAGAGG - Intergenic
987746196 5:21975319-21975341 TGCCAGCGCCATCTCCTGAGAGG + Exonic
987789156 5:22541629-22541651 TGTCACCTACATCCCCACTGGGG - Intronic
990456604 5:55994954-55994976 TGTCAGATCCTTCTCCGCAGAGG + Exonic
991022582 5:61995605-61995627 TGACAGATACATCGCCACAGGGG + Intergenic
991766403 5:69985430-69985452 TGCCAGCGCCATCTCCTGAGAGG + Intergenic
991780915 5:70132723-70132745 TGCCAGCGCCATCTCCTGAGAGG - Intergenic
991845636 5:70860513-70860535 TGCCAGCGCCATCTCCTGAGAGG + Intergenic
991873361 5:71133037-71133059 TGCCAGCGCCATCTCCTGAGAGG - Intergenic
992911379 5:81398969-81398991 TTTCAGCTACTTCCCCTTAGGGG + Intergenic
995705941 5:114989667-114989689 AGTCAGCTCCCTCTGCTCAGGGG + Intergenic
997689896 5:135821341-135821363 TTTCAGCTGCCTCTCCTCTGTGG - Intergenic
998783965 5:145689148-145689170 AGGCAGCTTCCTCTCCTCAGAGG - Intronic
1000929749 5:167236992-167237014 TGTCAGAAACATCTCCTCTTAGG + Intergenic
1001659410 5:173379558-173379580 TGTCGGCTCCAGCTCCTCAGGGG + Intergenic
1002174419 5:177393519-177393541 TTTCATCCACATGTCCTCAGTGG + Intronic
1007731873 6:43952269-43952291 TGTCAGCCACACCACCTCAAAGG + Intergenic
1010178301 6:73055305-73055327 TGGCAGCTACATCTGATCAATGG - Intronic
1014056753 6:117024910-117024932 TTTCAACTAAATCTCTTCAGAGG - Intergenic
1014826982 6:126057917-126057939 AGACAGCTCCATCTCCCCAGTGG + Intergenic
1015147762 6:130006318-130006340 TGTCAGCCAGGTCTCCTCAGAGG - Intergenic
1017710001 6:157158972-157158994 TGCCATTTACATCTTCTCAGAGG + Intronic
1020678966 7:11213552-11213574 TGTCATCTGCATCTGCTGAGTGG - Intergenic
1021241838 7:18211819-18211841 TCTCAGCTAAATGTCCTCACAGG - Intronic
1026139581 7:67694139-67694161 TGTCATCTCCATCTCCTCTCAGG + Intergenic
1027716003 7:81670734-81670756 TGTGAGCTATAGCTCTTCAGTGG + Intergenic
1029452403 7:100648527-100648549 TGGCAGCTCCATGTCCCCAGAGG + Intronic
1029930914 7:104370189-104370211 TGGCAGCAGCCTCTCCTCAGGGG - Intronic
1033577294 7:142697779-142697801 TGGCAGCAAGACCTCCTCAGTGG + Intergenic
1034764314 7:153703685-153703707 AGTCAGCTCCATCTCCTATGTGG - Intergenic
1037737560 8:21579686-21579708 TGTCAGCAACACCACCTAAGGGG + Intergenic
1040744408 8:50622849-50622871 TTTCAGTTACATCTTCTCAAAGG + Intronic
1042573352 8:70191522-70191544 TGTAAGGTTCATCTCTTCAGAGG - Intronic
1042879946 8:73476230-73476252 TCTCAGCTAAATGTCCTCAGAGG - Intronic
1043884401 8:85582135-85582157 TGTCAGCTGCATTAGCTCAGTGG - Intergenic
1043889228 8:85638049-85638071 TGTCAGCTGCATTAGCTCAGTGG + Intergenic
1045245711 8:100440188-100440210 TGTCTGATGCATCTCCACAGGGG - Intergenic
1047934311 8:129761842-129761864 TGTCAGTTACCTCCCATCAGTGG - Intronic
1050200409 9:3139677-3139699 TGTCTCTTACCTCTCCTCAGAGG - Intergenic
1056165664 9:83938650-83938672 CGTCAACTACATGTCCACAGGGG + Exonic
1056452616 9:86730711-86730733 TGACAGCTGCAGCTTCTCAGTGG - Intergenic
1058357900 9:104105482-104105504 TGCCAGCTAAATCTCGTTAGTGG + Intronic
1058777791 9:108302298-108302320 TGTCATCTACCTGTCATCAGAGG - Intergenic
1185701384 X:2233196-2233218 TGTCAGCCACAGCTGCACAGCGG - Intronic
1188105065 X:26139440-26139462 TGCCAGCTCCATGTGCTCAGAGG - Exonic
1189468133 X:41293435-41293457 TGCCAGCTTGATCTCCTCTGAGG - Intergenic
1192205106 X:69090400-69090422 TGTCCTCTACTTCTCCTGAGAGG + Intergenic
1192313246 X:70033454-70033476 TTTAAGCTACATCCCCGCAGCGG + Exonic
1194133241 X:90107183-90107205 TGTCAATTATATTTCCTCAGTGG - Intergenic
1197861836 X:130979469-130979491 TGTCTGCTACATGACCTCTGTGG - Intergenic
1199482381 X:148311725-148311747 TTTCAGCTCCATTTCCTCACAGG - Intergenic
1200479025 Y:3677267-3677289 TGTCAATTATATTTCCTCAGTGG - Intergenic
1202300847 Y:23412257-23412279 AGTCAGCAACATCTCCTTACTGG - Intergenic
1202569964 Y:26258341-26258363 AGTCAGCAACATCTCCTTACTGG + Intergenic