ID: 1091963613

View in Genome Browser
Species Human (GRCh38)
Location 12:4720033-4720055
Sequence CCCAGCGGATACCCCGAGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 5, 2: 8, 3: 20, 4: 48}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091963607_1091963613 -9 Left 1091963607 12:4720019-4720041 CCAGCCCCACACCACCCAGCGGA 0: 1
1: 12
2: 27
3: 60
4: 397
Right 1091963613 12:4720033-4720055 CCCAGCGGATACCCCGAGTCCGG 0: 1
1: 5
2: 8
3: 20
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091963613 Original CRISPR CCCAGCGGATACCCCGAGTC CGG Intronic
902443143 1:16444318-16444340 CCCAGCCGAGACCCCTAGTGGGG + Intronic
910100269 1:83568277-83568299 CCCCGCAGATACCCTGACTCTGG + Intergenic
916218507 1:162419894-162419916 CCCAGAGGGTACCCGGAGTCCGG - Intergenic
924775104 1:247111133-247111155 CCCGGCGGGTACCCCGAGTCCGG - Exonic
1064782368 10:18856671-18856693 CCCAGCAGGTACCCCGAGTCCGG + Intergenic
1077745275 11:4896435-4896457 CCCAGAGGAGACCCTGGGTCAGG + Intronic
1078317825 11:10306744-10306766 CCCTGCGGAGACCCTGAGTCCGG + Exonic
1083641184 11:64146258-64146280 CCTAGTGGATACCCTGAGACCGG + Intronic
1090998612 11:131889372-131889394 CCCAGCCCATACCCCCAGCCAGG + Intronic
1091624877 12:2114168-2114190 CCCAGGAGAGACCCCAAGTCAGG - Intronic
1091963613 12:4720033-4720055 CCCAGCGGATACCCCGAGTCCGG + Intronic
1094704031 12:32897089-32897111 CCCAGCGGATACCGCCTGCCGGG + Intergenic
1095095366 12:38145008-38145030 GCCAGTGGGTACCCCGAGTCCGG - Intergenic
1103719236 12:122964652-122964674 CCCAGCGCATCCTCTGAGTCAGG - Intronic
1107247918 13:38319747-38319769 CCCAGCGGGTACCCCGAGTCCGG + Intergenic
1111195373 13:84869689-84869711 CCCAGCAGGTATCCCAAGTCTGG - Intergenic
1116683794 14:48011733-48011755 CCCGGCGGGTACCCCGAGTCCGG - Intergenic
1121656695 14:95602276-95602298 CCCAGTGGAGATGCCGAGTCAGG + Intergenic
1125834290 15:42736585-42736607 CCCCGCGGCTACCCCGCGGCGGG + Exonic
1125968851 15:43895699-43895721 CCCTGCGGATACCGGGTGTCAGG - Intronic
1132376628 15:101332405-101332427 CCCACCGGATATCCCAAGACGGG - Intronic
1134567330 16:15262882-15262904 CCGAGCGGATTCCCAGAGTGTGG - Intergenic
1135075937 16:19393607-19393629 CCCAGTGGGTACCCTGAGTCTGG + Intergenic
1144958087 17:19029688-19029710 CCCAGAGGGTAGCCCCAGTCTGG - Intronic
1144977071 17:19144832-19144854 CCCAGAGGGTAGCCCCAGTCTGG + Intronic
1147587290 17:41659797-41659819 CCCAGCAGGTACCCAGAGCCAGG + Intergenic
1148953935 17:51337864-51337886 CCCATGGGACACACCGAGTCTGG + Intergenic
1153388469 18:4527644-4527666 CCCAGCGGGTACCCCGAGTCCGG + Intergenic
1156294944 18:35781050-35781072 TCCAGAGGATACCTTGAGTCAGG - Intergenic
1160087500 18:75790367-75790389 CCCAGATGATACCCTGAGTTGGG + Intergenic
1160789446 19:916921-916943 CTCAGCGGAGACCCTGAGTGAGG - Intergenic
1161120221 19:2521547-2521569 CCCAGGGGAGACCCTGGGTCAGG + Intronic
1161309288 19:3585359-3585381 CCCCGGGGATACCCGCAGTCCGG - Intergenic
1162656874 19:12137989-12138011 CCCAGAGGATAGCCTGAGGCAGG - Intronic
1164609490 19:29622423-29622445 CCCAGCAGGAAACCCGAGTCAGG + Intergenic
1167162867 19:47779077-47779099 CCCAGCGGAGCCCCGGAGTCGGG - Intronic
1167508625 19:49884129-49884151 CCCAGAGCAAACCCCGAGGCTGG + Intronic
929542367 2:42832149-42832171 CACAGCGGACACCCTGTGTCTGG - Intergenic
933066809 2:77808138-77808160 CCCAGTGGGTACCCCAAGTCCGG - Intergenic
933362355 2:81304456-81304478 CCCAGCTGGTACCCCAAGTCCGG + Intergenic
933418910 2:82023196-82023218 CCCAGTGGGTACCCTGAGTCTGG - Intergenic
933419855 2:82031232-82031254 CCCAGTGGGTACCCTGAGTCTGG - Intergenic
937715155 2:125024234-125024256 CCCAGTGGGTACCCTGAGTCCGG + Intergenic
937862574 2:126722551-126722573 CCCTGGGGATTCCCCGAGTCTGG + Intergenic
942830989 2:180237390-180237412 CCCAGCGGGTACCCGGAGTCTGG - Intergenic
943833208 2:192487900-192487922 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
943960439 2:194256185-194256207 CCCGGCCGGTACCCCGAGTCCGG + Intergenic
946945645 2:224819051-224819073 CCCAGCGTATACCCCTATTTGGG + Intronic
948335597 2:237204726-237204748 CCCACCAGCTACCCCGGGTCAGG + Intergenic
948796088 2:240402682-240402704 CCCAGCGGATCCCCTCAGTGCGG + Intergenic
1169083029 20:2809078-2809100 CCTAGCGGTTACCCCGAGTCCGG + Intergenic
1178620740 21:34172201-34172223 CCCAGAGGAGCCCCCTAGTCTGG + Intergenic
1182656765 22:31896888-31896910 GCCAGCGGATCACCTGAGTCAGG + Intronic
950193143 3:10992030-10992052 CCCAGCTGGTACCCAGAGCCTGG + Intergenic
957694551 3:83618435-83618457 CCCAGCGGGTACTCCGAGTCCGG + Intergenic
965104090 3:164337390-164337412 CCCATCGGAGACCCTGAGTGAGG + Intergenic
971244656 4:24917161-24917183 CACAGAGGATTCCCTGAGTCAGG - Intronic
973916007 4:55635820-55635842 CCCAGCGGAGACCCTGCGCCGGG - Intronic
976306544 4:83565694-83565716 CCCGGTGGGTACCCCGAGTCCGG + Intronic
976314791 4:83647951-83647973 CCCAGCTGATACCTCTACTCTGG + Intergenic
979126607 4:116980760-116980782 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
980733117 4:136848187-136848209 CCCAGGTGATACCCAGGGTCTGG - Intergenic
983327431 4:166274578-166274600 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
983842513 4:172474471-172474493 CCCAGAGGATGCCCAGAGCCTGG + Intronic
1006839845 6:37021744-37021766 CCCAGCGCATCCCCCGACTCAGG + Intronic
1019337731 7:493265-493287 CCCAGCGGATCCCAGGACTCCGG + Intergenic
1020002237 7:4762496-4762518 CCCAGCGGCGACCCCGAAGCTGG + Exonic
1020939216 7:14509780-14509802 CCCAGCAGGTACCCCGAGTCTGG - Intronic
1027978077 7:85184844-85184866 CCCAGCGGATAAGACGGGTCAGG - Intronic
1028192262 7:87867028-87867050 CCCAGTGGGTACCCCAAGTCTGG - Intronic
1033669104 7:143472697-143472719 CCCAGCGGGTACTCCGAGTCCGG - Intergenic
1039942636 8:42104287-42104309 CCCAGGGGATTCCCTGGGTCAGG + Intergenic
1040787072 8:51178618-51178640 CCCAGAGGGTACCCTGAGTCTGG + Intergenic
1043295335 8:78654629-78654651 CCCAGTGTGTACCCCAAGTCCGG - Intergenic
1057557768 9:96101231-96101253 CCCAGTGGATACCCTGCTTCAGG + Intergenic
1201783215 Y:17745357-17745379 CCCAGTGGGTACCCTGAGTCTGG - Intergenic
1201818338 Y:18160630-18160652 CCCAGTGGGTACCCTGAGTCTGG + Intergenic
1202113909 Y:21451813-21451835 TCCGGCAGGTACCCCGAGTCCGG + Intergenic
1202174576 Y:22085606-22085628 CCCAGTGGGTACCCCGAATCTGG - Intronic
1202216784 Y:22500776-22500798 CCCAGTGTGTACCCCGAATCTGG + Intronic
1202326403 Y:23695294-23695316 CCCAGTGTGTACCCCGAATCTGG - Intergenic
1202544369 Y:25974760-25974782 CCCAGTGGGTACCCCGAATCTGG + Intergenic