ID: 1091970774

View in Genome Browser
Species Human (GRCh38)
Location 12:4785093-4785115
Sequence ATGTGCAGAGAGCTGTGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091970774_1091970778 11 Left 1091970774 12:4785093-4785115 CCCTAGCACAGCTCTCTGCACAT 0: 1
1: 0
2: 2
3: 19
4: 225
Right 1091970778 12:4785127-4785149 TAATGTGGACGAATGACTAGTGG 0: 1
1: 0
2: 0
3: 3
4: 81
1091970774_1091970776 -4 Left 1091970774 12:4785093-4785115 CCCTAGCACAGCTCTCTGCACAT 0: 1
1: 0
2: 2
3: 19
4: 225
Right 1091970776 12:4785112-4785134 ACATAGATGTCCAATTAATGTGG 0: 1
1: 0
2: 1
3: 5
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091970774 Original CRISPR ATGTGCAGAGAGCTGTGCTA GGG (reversed) Intronic
900829688 1:4956974-4956996 ATGTGGAGAGGGATGGGCTAAGG - Intergenic
902393533 1:16119804-16119826 ATGTGGTGAGTGCTGTGCAATGG - Intergenic
904129207 1:28263101-28263123 AGGTGCAAAGAGCAGTGCTGGGG - Intronic
907757519 1:57325220-57325242 ATGTGTACAGAGATGTGCCAAGG - Intronic
908562072 1:65316432-65316454 ATGTGATGAGAGCTGTGATACGG - Intronic
911151035 1:94596863-94596885 ATGTGGAGAATGCTGTGCTATGG - Intergenic
911171913 1:94779108-94779130 ATGTGCTGAGTTCTGTGCTGGGG - Intergenic
912621436 1:111163327-111163349 ATGTTCATAGAAATGTGCTATGG + Intronic
913188529 1:116392893-116392915 AAGTGCATAGAGCTGTGCTGTGG + Exonic
915750406 1:158204213-158204235 ATATGCAGTGAGCTGAGCTGAGG - Intergenic
916786215 1:168088947-168088969 ATGTGTCGAGAGCTGTGAAAGGG - Intronic
917071155 1:171152326-171152348 ATATGCAAAGCACTGTGCTAGGG + Intronic
917635071 1:176927742-176927764 ATCTGCAGAAAGCTGAGCTTTGG - Intronic
919342724 1:196334282-196334304 ATTTGCAGAGTGTTGTTCTATGG + Intronic
919667983 1:200310789-200310811 GGATGCAGAGAGCTGGGCTATGG - Intergenic
919918095 1:202151489-202151511 ATGTGATGAGAGCTGTGATGGGG - Intronic
920058574 1:203211954-203211976 ATGTGGCAGGAGCTGTGCTAGGG - Intergenic
921993463 1:221392325-221392347 ATGTGCAGAGAGTATTTCTAAGG + Intergenic
922476644 1:225911278-225911300 ATGTGCAGAGGGCGCTGCTGGGG + Intronic
922786577 1:228285859-228285881 AGGTGCAGAGAGGTGGGCTCGGG + Intronic
922865949 1:228861692-228861714 ATAGGCTGAGAGCTGTGCTCTGG - Intergenic
924014104 1:239701171-239701193 ATGTGCAGAGTTCTATGCTTAGG - Intronic
924274538 1:242372241-242372263 GTGTGGAAATAGCTGTGCTATGG - Intronic
924945109 1:248841040-248841062 ATGTGCAGTGGGCAGTGCTGTGG + Intronic
1063406772 10:5803359-5803381 AGGTGCAGTGAGCCGTGATAAGG + Intronic
1064829908 10:19451291-19451313 TTGAGCTGAGAGCTGTGCTTGGG + Intronic
1065791358 10:29263529-29263551 ATGGGCAGACAGCTGGGCCATGG - Intergenic
1065844069 10:29730225-29730247 ATGTGCAAAGAAATGTACTAAGG + Intronic
1071179750 10:82969132-82969154 AACTGCAGAGAGCTGTGATATGG - Intronic
1071329151 10:84543311-84543333 ATAAGCAGAGAGCGGTGCTCGGG + Intergenic
1072121226 10:92407069-92407091 TGGTGCACAGAGCTGTGCTGGGG + Intergenic
1075392338 10:122101377-122101399 ATGTGCAGCCCACTGTGCTAAGG - Intronic
1075542077 10:123323079-123323101 ATGTCCAGAGAGTTTTCCTAGGG + Intergenic
1076011447 10:126992439-126992461 ATATGCAGAGCGCTGGGCTTTGG - Intronic
1076235056 10:128857582-128857604 ATGTGCAGTACGCTGTGCCATGG + Intergenic
1079119639 11:17672642-17672664 GTGTGCAGACAGCTGTAGTACGG - Intergenic
1080049712 11:27847119-27847141 ATGAGCAGGGAGCTCTGCTGGGG + Intergenic
1080216238 11:29844528-29844550 ATATGCAGAGTGATGTGATAGGG + Intergenic
1080557006 11:33427161-33427183 ATGGGCAGATGACTGTGCTAGGG - Intergenic
1082258639 11:50060418-50060440 ATGTGGAGAGAGCATTGCTGTGG - Intergenic
1082868005 11:57917514-57917536 AGGTGGAGAGAGCTTTGCTCTGG + Intergenic
1084167280 11:67381418-67381440 ATGTACAGAGTGCTCTGTTAAGG - Intronic
1085029777 11:73264137-73264159 ATGTGCCAAGCACTGTGCTAAGG - Intergenic
1085278947 11:75317730-75317752 CTGTGCTAAGAGCTGTGCTTAGG + Intronic
1085514699 11:77105430-77105452 GTGTGCAGAGAGCTGTGCTGAGG + Intronic
1085736220 11:79041461-79041483 ATGTGCCAAGAGTTGTGTTAAGG - Intronic
1087017019 11:93563934-93563956 AGGTGGTGAGTGCTGTGCTAAGG - Intergenic
1087834260 11:102855689-102855711 ATGTTCAGAGAGCTGCTCAACGG + Intergenic
1087975785 11:104544851-104544873 ATGTGCAGAGACCTGGGCTCTGG - Intergenic
1089057837 11:115601060-115601082 CTGGGCAGAGAACTGTGCAAAGG - Intergenic
1089181585 11:116586984-116587006 ATGTGCCAGGAACTGTGCTAAGG - Intergenic
1089701689 11:120248435-120248457 ATGTGCCAAGCACTGTGCTAAGG - Intronic
1090249239 11:125239842-125239864 GTGTGCAGAGAGCAGTGACAGGG + Intronic
1090865575 11:130697914-130697936 CTGTGCTGAGAGCTGCTCTAAGG - Intronic
1091349957 11:134885829-134885851 ATGTGCAGAGACCTTTACTGAGG - Intergenic
1091672472 12:2462198-2462220 CTGTGCAGAGAGCTGAGCCGAGG - Intronic
1091672504 12:2462337-2462359 CTGTGCAGAGAGCTGAGCCAAGG - Intronic
1091957478 12:4659359-4659381 GTTTGCAGGGAACTGTGCTATGG + Intronic
1091970774 12:4785093-4785115 ATGTGCAGAGAGCTGTGCTAGGG - Intronic
1094402804 12:30080649-30080671 AAGTGCAGCGAGCTGGTCTAGGG - Intergenic
1095190750 12:39255601-39255623 TTGCTCAGAGAGCTGTCCTATGG + Intergenic
1096111664 12:49032433-49032455 AGCTGCAGAGAGCTGGGCTGAGG + Exonic
1096689378 12:53310055-53310077 GTGGGCAGAGAGCTGTGTTCTGG - Intronic
1097982242 12:65746183-65746205 AGGTTCAGAGAGCTGGGATATGG - Intergenic
1099346177 12:81502643-81502665 ATGTGCTAGGAACTGTGCTAGGG + Intronic
1099533843 12:83821593-83821615 AGGTGCAGAGAGCTTAGGTAAGG + Intergenic
1099681270 12:85831479-85831501 ATATCCTGAGAGCTGTGCCAAGG - Intronic
1100116818 12:91315733-91315755 ATGGGCAAAGAACTTTGCTATGG - Intergenic
1101581547 12:106046625-106046647 AGGAGAAGAGAGCTGTGTTAAGG + Intergenic
1102219264 12:111183348-111183370 ATGGGCATAGAGCTGTGCCCAGG + Intronic
1102693204 12:114777910-114777932 ATGTGCTGGGAGCTGCGTTATGG - Intergenic
1102882673 12:116497688-116497710 ATGTGAAGGGAGTTGTTCTAGGG - Intergenic
1103737539 12:123070157-123070179 CAGTGAAGAGAGCTGGGCTAGGG - Intronic
1104915568 12:132262682-132262704 AGGTGCAGACAGATGAGCTATGG - Intronic
1104915584 12:132262759-132262781 AGGTGCAGACAGATGAGCTATGG - Intronic
1108278599 13:48838343-48838365 ATGTGCTAAGTGCTGTGCTTGGG + Intergenic
1111828117 13:93294658-93294680 ATGTACACATTGCTGTGCTATGG - Intronic
1111909657 13:94296570-94296592 AAGTGCTGAGAGCTGGGATAAGG - Intronic
1112431950 13:99358048-99358070 ATGTGCTGAGAGCTGTCCTGGGG + Intronic
1112503405 13:99958793-99958815 ATGTGCCAAAAGCTGTGCTTGGG + Intergenic
1113351332 13:109532296-109532318 ATGTGCAGGGAACTGTGACAGGG + Intergenic
1115841152 14:37471914-37471936 ATGTGCTGGGCGCTTTGCTAGGG - Intronic
1119599746 14:75967569-75967591 AGGTGCAGACAGCTGTGTTGGGG + Intronic
1121805801 14:96821205-96821227 ATGTGCCAGGAACTGTGCTAGGG - Intronic
1123476584 15:20595683-20595705 ATGTGCAGAAAGCAGGGCTCAGG - Intergenic
1123641427 15:22404681-22404703 ATGTGCAGAAAGCAGGGCTCAGG + Intergenic
1124685467 15:31778115-31778137 ATGTGCAGAGAGTAATTCTAAGG + Intronic
1125051732 15:35306804-35306826 CTCTGCAGAGAGCTCTGCTGAGG - Intronic
1126894409 15:53242807-53242829 ATGTGCAGAGGACTTTGCCAAGG - Intergenic
1127690157 15:61387435-61387457 ATGTACAGACAGCTGAGTTAAGG + Intergenic
1128118948 15:65132009-65132031 ATATAGAGAGAGGTGTGCTAAGG - Intronic
1128328479 15:66740625-66740647 AGGTGCTGAGTACTGTGCTAGGG + Intronic
1128429495 15:67577393-67577415 ATGTGCAGAGCTTTGTGTTAGGG + Intronic
1128680776 15:69649790-69649812 ATGTGCAGATTTCTGTGATAGGG + Intergenic
1128818289 15:70630021-70630043 ATGTGCAGAGAGCCGGGATGGGG - Intergenic
1129745365 15:78015757-78015779 ATGTGCCAGGAGCTGTGCTAAGG - Intronic
1130300898 15:82679564-82679586 TTGTTCAGGGAGCTGGGCTAAGG - Intronic
1131302431 15:91211187-91211209 CTGAGGTGAGAGCTGTGCTAAGG + Intronic
1131900811 15:97085862-97085884 AGGTGCAGGGAGCTGCACTACGG - Intergenic
1132223118 15:100119715-100119737 ATGTGGAGGGAGGTGTGCCAAGG - Intronic
1132895122 16:2225236-2225258 ATGTGCCGAGAGCAGTGTTGGGG + Intronic
1135299987 16:21317981-21318003 GTGTAGAGAGAGGTGTGCTAGGG - Intergenic
1135745654 16:25014790-25014812 CTGTGCCGAGCGCTGTGCTGTGG - Intronic
1135756944 16:25106660-25106682 CTGTGCCGAGCGCTGTGCTGTGG - Intergenic
1137536818 16:49333562-49333584 GGGTGCGCAGAGCTGTGCTAGGG + Intergenic
1138389161 16:56657817-56657839 GTGTGCAGCGAGCTGCGCTCAGG + Exonic
1139311517 16:66031979-66032001 CTGTGCAGAGAGCTGTGGCTGGG - Intergenic
1139997958 16:70998183-70998205 TTGTGCAGGGCACTGTGCTAGGG - Intronic
1141142952 16:81509255-81509277 AGGTGCAGAGAGATGTGGCATGG + Intronic
1143060496 17:4196593-4196615 ATATGCAAAGGGCCGTGCTATGG + Intronic
1143093723 17:4465396-4465418 ATGAGCAGAAAGTTGTGCTCAGG - Intronic
1143433428 17:6904011-6904033 ATGTGCAGAGAGCTAGACTGAGG + Intronic
1144401227 17:14904450-14904472 GTGTCCGAAGAGCTGTGCTAGGG - Intergenic
1144721665 17:17475471-17475493 TGCTGCAGAGAGCTGTGCTGAGG + Intergenic
1145264876 17:21375001-21375023 ATGTTCTGAGCTCTGTGCTATGG - Intergenic
1146589243 17:34114278-34114300 ATGAGCCAAGAGTTGTGCTAAGG - Intronic
1147982337 17:44282315-44282337 GTGTGCATGGAGCTGTGCTAAGG - Intergenic
1149689230 17:58560157-58560179 ATGTCCAAAGCACTGTGCTAGGG - Intronic
1150207263 17:63418550-63418572 TTGAGCTGAGGGCTGTGCTATGG - Intronic
1150494838 17:65599375-65599397 ATGTGCTGGGCACTGTGCTAAGG + Intronic
1150843353 17:68630204-68630226 ATGTGCTAAGCTCTGTGCTAAGG - Intergenic
1153189587 18:2522741-2522763 ATGTGCAGAGAGCTGGGGTGGGG - Intergenic
1153603914 18:6811584-6811606 AAGTGCAGAGGGCTGTGGGAGGG + Intronic
1157747705 18:50150925-50150947 GTGTGAAGAGAGGTGTGCCAGGG - Intronic
1157984107 18:52417950-52417972 ATGCGGACAGAGCTGCGCTATGG - Intronic
1161427593 19:4212478-4212500 ATGTGCAGGGAGCTGGCCTCCGG - Exonic
1162176399 19:8832935-8832957 ATTGGCAGAGAGCAGTTCTAGGG + Intronic
1162943987 19:14031486-14031508 ATGTGCCCAGAGCTCTCCTAGGG - Intergenic
1163485357 19:17582344-17582366 GTGTGCAGGGAGCTGAGCTATGG + Exonic
1165813668 19:38627854-38627876 ATGTGCAGAGAACTGGCCTGGGG - Intronic
1167737550 19:51305442-51305464 ATGGGCAGAGAGCTGTCCTTTGG - Intergenic
925842270 2:8003640-8003662 AAGTGCACAGAGCTGGGATATGG + Intergenic
927017454 2:18979949-18979971 ATGTGCAGAAAGCTCTGAGATGG + Intergenic
927710718 2:25324216-25324238 ATGTGCCAAGCACTGTGCTAAGG + Intronic
928082050 2:28320316-28320338 ATGTGCAGAGCACCATGCTAAGG + Intronic
928200647 2:29245786-29245808 ATGTGCAGGGCACTGAGCTATGG - Intronic
929298787 2:40277854-40277876 ATGTGCAGGGCACTGTCCTAAGG + Intronic
930897271 2:56460945-56460967 ATGTTCAAAGAGCTGGGCCAGGG + Intergenic
931161042 2:59691015-59691037 CAGTGCAGAGGGCTGTGCTGGGG + Intergenic
933771724 2:85748888-85748910 ATGTGCAGAGGGCAGTGCCCAGG - Intergenic
934040568 2:88124659-88124681 ATGAGCTGAGACCTGTGCAAAGG - Intronic
934943462 2:98519364-98519386 AAGTGGAGGGTGCTGTGCTATGG - Intronic
935841328 2:107114706-107114728 ATGTTAAAAGTGCTGTGCTAAGG - Intergenic
936846416 2:116840425-116840447 AAGTGGAGAGAGCTGAGCTATGG - Intergenic
936998212 2:118436850-118436872 ATCTGCAGAGAGCTGTGGTGTGG + Intergenic
939832041 2:147083969-147083991 ATGTGCTGAGCTCTGTGCTCTGG - Intergenic
942086231 2:172446523-172446545 ATGTGCCGAGCACTGTGCAAAGG + Intronic
942581973 2:177429328-177429350 AAGGGCAGAGAACTGGGCTAAGG - Intronic
946717849 2:222571978-222572000 ATGTGCAGAGATCTTTGCCAGGG - Exonic
946738165 2:222775159-222775181 ATCTGCTGAGTGCTGTGCTATGG - Intergenic
947395618 2:229683943-229683965 CTGTGCAGAGCACTGTGTTAGGG + Intronic
1169191234 20:3660289-3660311 CTGTGCTGAGCCCTGTGCTAGGG - Intronic
1171206135 20:23282863-23282885 GTGGGTAGAGAGCTGTGCTCTGG + Intergenic
1172577049 20:36017485-36017507 ATTGACAGAGGGCTGTGCTAGGG - Intronic
1172679362 20:36700511-36700533 ATGTGCAGAGACCCTGGCTAAGG + Intronic
1174375123 20:50121501-50121523 CTGTGCAGAGAGCTCTGGCATGG - Intronic
1175031932 20:55963325-55963347 ATGTGCAAGGCACTGTGCTATGG + Intergenic
1175245143 20:57577799-57577821 ATGTGCAGAAGGGTGTGCTAGGG - Intergenic
1177712613 21:24798319-24798341 ATTGGCAGAGAGCTTTGCTGAGG + Intergenic
1177876685 21:26641871-26641893 ATGTGCAGAAAACTGTGCTATGG + Intergenic
1180855144 22:19040835-19040857 CTGTGCAGAGAGCTCTGAGAAGG - Intronic
1185346734 22:50313677-50313699 ATGTGCAGAGCGCCCTGCTGCGG - Exonic
950454874 3:13086699-13086721 CTGTGCAGAGAGCTGAGGGAGGG - Intergenic
950473788 3:13203416-13203438 GTGGGCAGAGAGATGGGCTATGG - Intergenic
955692589 3:61605190-61605212 ATGTGCTGAGGACTGTGTTAGGG + Intronic
955856270 3:63277304-63277326 ATGAGCTGAAAACTGTGCTAAGG - Intronic
957380215 3:79418016-79418038 ATGTGTCCAGTGCTGTGCTAGGG - Intronic
957998181 3:87717681-87717703 ATCTGCAGAAAGCTGTACTGGGG - Intergenic
959635148 3:108558510-108558532 ATGTGCCAAGTGCTATGCTAGGG + Intronic
960678756 3:120225148-120225170 ATGTGCACGGTGCTCTGCTAGGG + Intronic
961645694 3:128391689-128391711 ATGTGTAGAGAAATGTGCAAAGG - Intronic
962740658 3:138360784-138360806 CTGAGCAGAAAGCTGTGCCAGGG + Intronic
962848978 3:139293856-139293878 CTGTGCCAAGAACTGTGCTAGGG - Intronic
963902025 3:150742189-150742211 ATCTGCAAAAAGATGTGCTATGG + Exonic
969628718 4:8322828-8322850 ATGTTCAGAGTTCTGAGCTAAGG + Intergenic
969630915 4:8335492-8335514 ATGGGGAGAGAGCAGTGCTGCGG + Intergenic
969938858 4:10710197-10710219 AAGTGCAGAGATCTGGGCTCTGG + Intergenic
970520227 4:16876010-16876032 ATGTGCAGAGTGATGGGCTGGGG + Intronic
970927999 4:21475381-21475403 ATGTGGAATGAGCTGTGGTACGG - Intronic
971135928 4:23868507-23868529 ATGTGCACAGCTTTGTGCTAGGG + Intronic
971139744 4:23911248-23911270 ATGTGCCCAGTGCTATGCTAGGG - Intergenic
971812514 4:31444898-31444920 ATGAGCAGATAGCTGAGGTAGGG + Intergenic
974388170 4:61230207-61230229 ATGTGCCAATAGCTGTGTTAAGG - Intronic
976309551 4:83597002-83597024 AAGGGCAGAGATCTGGGCTAAGG - Intronic
979338638 4:119492931-119492953 ATGTGCACACACCTGTGCAAAGG - Intergenic
979540358 4:121873872-121873894 ATGTGCATAGAGCTCTGCCTGGG + Intergenic
980662434 4:135880823-135880845 ATTTGCAGAGAGGTTTTCTAGGG - Intergenic
981124358 4:141089055-141089077 ATGTCCAGTGAGGTGTTCTATGG + Intronic
982542864 4:156696414-156696436 ACGTGATGAGAGCTGTGCTGAGG - Intergenic
987128675 5:14840141-14840163 ATGTTCAGAGAGGCGTGGTAAGG - Intronic
987410839 5:17613281-17613303 ATCTGTAGAGAGTAGTGCTATGG + Intergenic
988514994 5:31896525-31896547 ATGTGCCAAGCCCTGTGCTAAGG + Intronic
991686816 5:69189365-69189387 ATGTGTAGAGTGCTGAGTTAGGG - Intergenic
992762827 5:79966385-79966407 ATGTGCGAAGCTCTGTGCTAGGG + Intergenic
992957942 5:81929790-81929812 ATGTGCAGGCTGCTGTGCTAGGG - Intergenic
994045268 5:95302177-95302199 AAATGCAGAGAACTGTCCTAGGG + Intergenic
995274050 5:110258187-110258209 AGATTCAGAGAGCAGTGCTATGG - Intergenic
995778878 5:115755095-115755117 ATGTGAAGAGAGCTGCCCCATGG - Intergenic
995780672 5:115772034-115772056 AAGTCCAGAGAGCTGACCTAGGG + Intergenic
997337481 5:133118414-133118436 TTGGGCACAGAGCTGTGCGATGG + Intergenic
998354744 5:141525576-141525598 TTGTGCATACAACTGTGCTAAGG + Intronic
1000231358 5:159318273-159318295 ATGTGTCTAGAGCTGTGCCAAGG - Intronic
1001133074 5:169080344-169080366 ATGTGCCAAGCACTGTGCTAGGG + Intronic
1002829198 6:803796-803818 ATGAGGAGAAAGCTGTGCTGTGG - Intergenic
1007159580 6:39778203-39778225 GTGTGCCAAGCGCTGTGCTAGGG - Intergenic
1010354399 6:74914326-74914348 ATGTGCAAAAACCTATGCTAAGG - Intergenic
1012923373 6:105243320-105243342 CTCTGCAGAGAGCACTGCTAAGG - Intergenic
1013174206 6:107663481-107663503 TTGTGCAGGGCCCTGTGCTAAGG + Intergenic
1014997072 6:128160707-128160729 ATTTGCAGTGCACTGTGCTAAGG - Intronic
1015669429 6:135672076-135672098 ATGTGCAGACAGCTGGGCCTGGG + Intergenic
1017122276 6:151035574-151035596 CTGTGCACAGAGCAGTGCTTGGG - Intronic
1019481344 7:1268296-1268318 CTGAGGAGAGAGCTGTGCCAGGG + Intergenic
1028160664 7:87481047-87481069 ATGTGCAAGGACCTGGGCTAAGG + Intergenic
1035460116 7:159033352-159033374 CTGTGCACAGAGCTGTACCATGG - Intronic
1035725029 8:1818908-1818930 ATGTGCAGAGACCGGTGTCAGGG - Intergenic
1037064673 8:14563066-14563088 AACTGAAGATAGCTGTGCTATGG + Intronic
1037860496 8:22401964-22401986 ATATGCAGAAAGATGTGTTATGG - Intronic
1037992104 8:23328423-23328445 GTCTGCAGAGAGCTGGGCTTTGG - Exonic
1038330268 8:26602813-26602835 ATGTGAAGATTGCTGTACTAAGG + Intronic
1039326833 8:36494828-36494850 CTGAGCAAAGAACTGTGCTAAGG + Intergenic
1039619016 8:38979478-38979500 TTGTGTAGAGAGCTGTGGAATGG + Intronic
1041305255 8:56451029-56451051 ATGTGCAAACATCTGTGCTGTGG - Intergenic
1042306577 8:67339691-67339713 CTCTGCAGAGAGCTGTAGTAGGG + Intronic
1043388740 8:79770925-79770947 ATGTGCCATGTGCTGTGCTAGGG + Intergenic
1043574562 8:81643047-81643069 ATGAGCAGAGAGCTGAACTCTGG + Intergenic
1044121759 8:88405824-88405846 ATGTGCAGGTAACTGTGCAATGG - Intergenic
1049022216 8:139965194-139965216 ACGTGCAAAGCACTGTGCTAGGG - Intronic
1050062916 9:1729323-1729345 ATGTGGAGAGAGGGCTGCTATGG - Intergenic
1052168694 9:25366222-25366244 ATGTGCCAGGTGCTGTGCTAAGG + Intergenic
1054766413 9:69046071-69046093 ATGTGGAGAGATCTGTGCTCTGG + Intronic
1056797134 9:89666387-89666409 ATGTGCAGGGAGCAGGGCTGGGG + Intergenic
1056947392 9:91010459-91010481 ATGTGAGGAGTGCTGTGCTGGGG + Intergenic
1057486969 9:95493227-95493249 CTGTGCAGAAGGCTGTGCTGAGG - Intronic
1059073197 9:111161370-111161392 AGGTGTGAAGAGCTGTGCTAAGG - Intergenic
1059686619 9:116643669-116643691 ATGTGCCAAAAACTGTGCTAAGG - Intronic
1059771652 9:117432181-117432203 AAGTGCAGAGCACTGTTCTAGGG - Intergenic
1060600883 9:124876572-124876594 CTGTGCAGTGAGCTGTGATCTGG + Intronic
1060730844 9:126036059-126036081 ATGTGCCAAGCACTGTGCTAAGG + Intergenic
1060740167 9:126092581-126092603 ATGTCCACAGAGCAGTGCTGGGG + Intergenic
1062208240 9:135348942-135348964 ATGTGCAGAGATCGGTGTGAGGG + Intergenic
1062483928 9:136764890-136764912 AGCTGCAGAGAGCTGGGCTGGGG + Intronic
1185805291 X:3051322-3051344 ATCTCCTGAGGGCTGTGCTATGG + Intronic
1187579973 X:20596931-20596953 ATGTGAAGAAAGCTGTGAAATGG + Intergenic
1189225392 X:39409115-39409137 AAGTGCAGAGAGCTGGGGAAAGG - Intergenic
1193164387 X:78264424-78264446 ATCTGCAGAGTTCTGTGCTTGGG + Intergenic
1193230805 X:79043661-79043683 CTTTTCAGAGAGCTGTGCTTTGG + Intergenic
1195682640 X:107560387-107560409 ATGTGGAGTGAGTTGTGCTGCGG + Exonic