ID: 1091970935

View in Genome Browser
Species Human (GRCh38)
Location 12:4786375-4786397
Sequence AATTAGTACCTTAATGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 241}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091970935 Original CRISPR AATTAGTACCTTAATGAAGA TGG (reversed) Intronic
904578699 1:31523738-31523760 AATAAGTACTTTCATGAACATGG - Intergenic
904950966 1:34238474-34238496 AATTAGTTCCTTTCTGGAGATGG - Intergenic
905590717 1:39160917-39160939 AGTCAGTAACTAAATGAAGAGGG - Intronic
906979070 1:50608606-50608628 AAGTAGTGTCTTACTGAAGAAGG + Intronic
908094809 1:60726444-60726466 AATTAGTACCACAGAGAAGATGG + Intergenic
908292004 1:62677171-62677193 AATTAGTTCCTTACCAAAGAAGG - Intronic
909758980 1:79266006-79266028 AATTAGTACCCTTATAAAAAAGG + Intergenic
910227540 1:84951340-84951362 GTTTAGTCCCTTAATGAACAGGG + Intronic
913025625 1:114835978-114836000 AATTAGTTTATTATTGAAGAAGG - Intergenic
913261193 1:116999576-116999598 TATTAATACCTCAAAGAAGAGGG - Intergenic
914452436 1:147804523-147804545 TATTGCTACCTTAATGATGAAGG - Intergenic
915692962 1:157708899-157708921 AATAAGTACCTTATTAAACAAGG + Intergenic
916288967 1:163142728-163142750 AATTATTACATTATTGAAGTTGG + Intronic
916326558 1:163566866-163566888 GATTATGACCTTAATGAAAAAGG - Intergenic
916778404 1:167995023-167995045 AATTAGGAAATTGATGAAGAAGG + Intronic
917703704 1:177609274-177609296 AATAAGTATCTTTATGAATATGG - Intergenic
918933292 1:190885732-190885754 AATTAATACAATAATGAATAGGG - Intergenic
919121050 1:193340560-193340582 AAGAAGTACTGTAATGAAGAGGG + Intergenic
919184148 1:194121935-194121957 CATTAATCCCTTAATGAGGAAGG + Intergenic
919607544 1:199704280-199704302 AAATAGTAGATTAATTAAGAAGG - Intergenic
920888804 1:209961656-209961678 TATTATTATCTTACTGAAGAAGG + Intronic
920958422 1:210641061-210641083 AATTCGTACCCTAAAGAACAAGG - Intronic
924837879 1:247672645-247672667 TAATAGTACTGTAATGAAGAGGG + Exonic
1063726377 10:8641936-8641958 ATTTAGGACATTAATGAGGAAGG + Intergenic
1066112483 10:32209718-32209740 AATTGGTAGCTTGATGGAGATGG + Intergenic
1066300141 10:34089026-34089048 ATTTAGCACTTTAATGAATATGG + Intergenic
1068726044 10:60304694-60304716 AATTTTTACCTTTATAAAGATGG + Intronic
1070094047 10:73319076-73319098 AATAAGTAACTTAAACAAGAAGG + Intronic
1071663208 10:87527088-87527110 CATTGGTAGCTTAATGAGGATGG + Intronic
1072184827 10:93026934-93026956 AATGATTAACTTAATGAGGAAGG + Intronic
1072323068 10:94269864-94269886 AATTACTACCTTCATTCAGAGGG + Intronic
1072481239 10:95810619-95810641 ATTTTGTACCTGAGTGAAGAAGG - Intronic
1076850942 10:133092715-133092737 AAGAAGCACCTGAATGAAGAAGG + Intronic
1079770401 11:24451697-24451719 CATTGGTACCTTGATGGAGATGG - Intergenic
1080299062 11:30763959-30763981 AATTAGTACATCAAAGAGGATGG - Intergenic
1080968465 11:37242248-37242270 CATTGGTAGCTTGATGAAGATGG + Intergenic
1081019845 11:37931584-37931606 AATGAATACCTTAATTATGAAGG - Intergenic
1081366474 11:42241432-42241454 AGTTAGTTCATTAATGAAGGTGG - Intergenic
1081384445 11:42454602-42454624 TATTAATCCCTTCATGAAGACGG - Intergenic
1081649113 11:44811863-44811885 GACAAGTTCCTTAATGAAGATGG + Intronic
1082616688 11:55370060-55370082 ACTTTTTACCTTAATAAAGATGG - Intergenic
1083326350 11:61874869-61874891 AATAAGTACATTACAGAAGATGG - Intronic
1086143036 11:83519983-83520005 AATTAATACCATAATGAATTTGG - Intronic
1087345972 11:96971486-96971508 AATTGGAACGTTAATGGAGAAGG + Intergenic
1087466157 11:98509238-98509260 AATTAGTGTCTTAATGAACAGGG + Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1087573711 11:99963700-99963722 AATTAGTAGCTTGATGGGGATGG + Intronic
1088010706 11:104997437-104997459 GATGAGTTCCGTAATGAAGATGG + Exonic
1089943596 11:122444409-122444431 AATTAGCAAATTAATGAAAAGGG - Intergenic
1090237411 11:125159754-125159776 CATCAGTACCATAAAGAAGATGG + Intergenic
1090296420 11:125592409-125592431 AATTTCTACCTTAAAAAAGACGG + Intronic
1091096673 11:132829420-132829442 AATGAGTCAATTAATGAAGATGG + Intronic
1091488527 12:913096-913118 AACTATTATGTTAATGAAGATGG - Exonic
1091970935 12:4786375-4786397 AATTAGTACCTTAATGAAGATGG - Intronic
1093636849 12:21480854-21480876 ACTTAGAAACTTAATGAAGAGGG - Intronic
1094689883 12:32758199-32758221 ATTTAGTACCTTAATACATAGGG + Intergenic
1095475867 12:42587223-42587245 AATTAGTACCAAATTAAAGATGG + Intronic
1096013995 12:48250511-48250533 ATTTTGTACCTTAATTAAGAAGG - Intergenic
1097611528 12:61827970-61827992 AATAAAGACATTAATGAAGATGG + Intronic
1098163101 12:67666375-67666397 TATTTCTACCTTAATGCAGATGG - Intergenic
1099025879 12:77463856-77463878 CATTGGTAGCTTAATGAGGATGG - Intergenic
1099195704 12:79613038-79613060 GATTAGTTCCTTTATAAAGAAGG + Intronic
1100805146 12:98275558-98275580 CATTAGTATCCTAATGAGGAAGG + Intergenic
1102267335 12:111498103-111498125 AACTAGTACCATACTGAAAAGGG + Intronic
1102596227 12:113994474-113994496 AATTTGTATCTTTATAAAGAGGG + Intergenic
1105620289 13:22060038-22060060 AATTAGTACCATCATGTACATGG + Intergenic
1106998392 13:35515185-35515207 CATTATTACCTTCATGTAGAGGG + Intronic
1107026445 13:35806641-35806663 AGTTAGAAACTGAATGAAGAAGG - Intronic
1109515372 13:63437083-63437105 AATTAGTACCATGAGTAAGAAGG - Intergenic
1109684679 13:65802144-65802166 AAGTAGGACCTTACTGAAAAGGG + Intergenic
1109757420 13:66778756-66778778 AATTAGTACCTCTATGAATCAGG - Intronic
1110759268 13:79212662-79212684 ATTAAATACCTTAATGTAGATGG - Intergenic
1110949389 13:81465253-81465275 AATTATTTCCTTAATAAAAATGG - Intergenic
1111794258 13:92897551-92897573 TTTTAGTACCTTAACCAAGATGG - Intergenic
1111879317 13:93935304-93935326 AATAAGTACCTATATAAAGATGG - Intronic
1112543082 13:100336492-100336514 AATTAGTGGCTTAATGAACAAGG + Intronic
1113260323 13:108554389-108554411 AATTACTACCTTTATGATGTTGG + Intergenic
1113260416 13:108555386-108555408 AATTACTACCTTTATGATGTTGG - Intergenic
1113288599 13:108880905-108880927 CATTGGTAGCTTGATGAAGATGG + Intronic
1114970763 14:28025674-28025696 CATTAGAACCAAAATGAAGAAGG + Intergenic
1115025493 14:28740278-28740300 AAATATTGCCTTAATGAACAGGG + Intergenic
1115689928 14:35832082-35832104 AATTAGTTGCTCAATGAACAAGG - Intronic
1116404661 14:44553092-44553114 CATTAGTACCTTGATGGGGATGG + Intergenic
1116741472 14:48760671-48760693 AAATAGTACTTTAATAAACATGG + Intergenic
1117750113 14:58912878-58912900 AAAAAGTTCCTTATTGAAGAAGG + Intergenic
1118103737 14:62634602-62634624 AATAAGTCCCTTAATTAAAAAGG + Intergenic
1119988576 14:79168889-79168911 AATTTGTACTCTAATGAAGGAGG - Intronic
1121589489 14:95091871-95091893 ATCTAGTGGCTTAATGAAGAGGG - Intronic
1123982841 15:25619662-25619684 AATTAGTACACCAATGAAGCTGG + Intergenic
1125073619 15:35586529-35586551 AATTAGTAGCTTATTTAATAGGG + Intergenic
1125081744 15:35682228-35682250 AGCTAGTACCTCAATGAAAAAGG - Intergenic
1125183261 15:36901720-36901742 ATTTTGTACCTTTATGAATATGG + Intronic
1126860396 15:52877377-52877399 AATTTGTTCCTTAAGGAAAAGGG - Intergenic
1127178640 15:56389970-56389992 ATTTAATAACTTACTGAAGATGG - Intronic
1127761421 15:62143384-62143406 CATTGGTAGCTTGATGAAGATGG + Intergenic
1129560394 15:76560214-76560236 AATTAGTACCCTTGTGAAGGAGG + Intronic
1130277949 15:82492681-82492703 AATGAGTCCCTTGATGCAGATGG - Intergenic
1130774929 15:86968905-86968927 AATTAGCGCCTTTATAAAGAAGG - Intronic
1131865362 15:96702939-96702961 AATTAGTTCCTGACTGTAGATGG - Intergenic
1132982323 16:2744818-2744840 AATTAGTACCTGGCTGCAGAGGG + Intergenic
1138867553 16:60841544-60841566 AATTAGTACATTGCTGCAGATGG + Intergenic
1140355074 16:74298188-74298210 GATTTGAACCTTAATGAATAAGG + Intronic
1146434967 17:32836080-32836102 AATTAGTATTTTAATGCAAAGGG + Intronic
1149149834 17:53548142-53548164 CATTTATGCCTTAATGAAGATGG - Intergenic
1150998565 17:70347629-70347651 CATTAGTTCATTAATGAAGGTGG + Intergenic
1152167505 17:78719917-78719939 ACTTAGTACCTTAAAAAGGAAGG + Intronic
1152395145 17:80028091-80028113 ATTTGGAACCTTAACGAAGATGG - Intronic
1154007131 18:10541312-10541334 AATTAGGACTTTAATCATGAAGG + Intronic
1158224264 18:55184317-55184339 AAGTAGTAACTTAATTAGGATGG + Intergenic
1165156768 19:33793444-33793466 AATTAGGATCTTAATAAGGAAGG - Intergenic
1167175881 19:47864055-47864077 GATTAGTTTATTAATGAAGATGG + Intergenic
925109400 2:1321020-1321042 AATGAATAAATTAATGAAGAAGG + Intronic
926995185 2:18727643-18727665 AATTAGTTTCTAAATGAAGATGG + Intergenic
927384403 2:22516348-22516370 AAGTAGGACTTTACTGAAGAGGG - Intergenic
929402759 2:41604306-41604328 CATTGGTAGCTTAATGGAGATGG + Intergenic
930757447 2:54991391-54991413 AATTTCTACCTAAATGAATATGG + Intronic
933595566 2:84279751-84279773 TCTGAGTACCATAATGAAGAAGG + Intergenic
934803671 2:97195351-97195373 AATTATTTTCTGAATGAAGACGG + Intronic
934804087 2:97200959-97200981 AATTATTTTCTGAATGAAGACGG + Intronic
934832960 2:97550833-97550855 AATTATTTTCTGAATGAAGACGG - Intronic
938957345 2:136310695-136310717 AATTAGTACTAAAATGAAGGAGG + Intergenic
939077183 2:137617864-137617886 AATTAGTACCTTTATAAAGGAGG - Intronic
939190124 2:138907570-138907592 AAATAATACTTTAATGAACATGG + Intergenic
939826415 2:147021108-147021130 AATCAGTACCCCATTGAAGAAGG + Intergenic
940489518 2:154340242-154340264 AATAAGTAAATAAATGAAGAAGG - Intronic
940794957 2:158068104-158068126 ATTTAGTTACTTAATGAAAATGG + Intronic
941273715 2:163463487-163463509 AATTAATATCATAATGAAGACGG + Intergenic
941375826 2:164729414-164729436 AATTTGTACATTAAAGAAAATGG + Intronic
941552715 2:166936955-166936977 TATTGGTAGCTTAATGAGGATGG + Intronic
943703983 2:191015633-191015655 AATTAGTTCCTTCAAGTAGACGG + Intronic
944256824 2:197631443-197631465 AATAAGTACTATAATGAAGTTGG + Intronic
945105345 2:206307162-206307184 AATTAGTCACTGAATGAAGAGGG - Exonic
945332721 2:208558329-208558351 AATTAGTATTTTAAAGAAAATGG + Intronic
947887798 2:233588912-233588934 ATTAAATACTTTAATGAAGATGG + Intergenic
948407920 2:237736792-237736814 AATTAGCACCATGAGGAAGACGG + Intronic
1169904171 20:10583987-10584009 ATTTAGCACCTTAATTAAGATGG + Intronic
1173145581 20:40521375-40521397 AATTCCCACCTTAATGAAGTGGG + Intergenic
1174894972 20:54438695-54438717 CCTTAGTACCCCAATGAAGAAGG - Intergenic
1175628000 20:60505146-60505168 GATGAGTACCTAAATGAAAAAGG + Intergenic
1176760162 21:10774220-10774242 CATTGGTAGCTTGATGAAGATGG - Intergenic
1177095501 21:16826871-16826893 AATTAGTACCGTTATGAAACAGG + Intergenic
1177625213 21:23650613-23650635 AAGTTGGACCTTAATGGAGATGG - Intergenic
1178010279 21:28277071-28277093 AATTAATTCCTTAATACAGAAGG + Intergenic
1178190550 21:30274727-30274749 AATTTGTACATGAATAAAGAAGG + Intergenic
1178428147 21:32495733-32495755 AATTAGAATCTAAACGAAGAAGG - Intronic
1179437514 21:41372365-41372387 AAATAGTTTCTTAATAAAGATGG - Intronic
1181785941 22:25227235-25227257 AAATAGTACATTAAAGAGGAAGG - Intronic
1181818130 22:25455094-25455116 AAATAGTACATTAAAGAGGAAGG - Intergenic
1182168000 22:28195885-28195907 CATTGGTAGCTTAATGGAGATGG - Intronic
1182169605 22:28213728-28213750 CATTGGTAGCTTAATGGAGATGG - Intronic
953457523 3:43054726-43054748 CTTTAGTACCTTAAAGAATATGG - Intronic
953479641 3:43239791-43239813 AATTAGTAGCTTAGAGAAGAAGG - Intergenic
955470883 3:59284845-59284867 AATTCACACTTTAATGAAGAGGG - Intergenic
956292716 3:67678416-67678438 AATTATTATCTTTATGCAGATGG - Intergenic
956330975 3:68107906-68107928 AATTAGTACCCTAATGACTAGGG - Intronic
956662384 3:71611992-71612014 ACTTAGAAGCTTAATAAAGATGG + Intergenic
957510270 3:81179253-81179275 GATTAGTACCTTTATGAAAGAGG + Intergenic
960796862 3:121496474-121496496 AATCAGTACCTTAATGAGAAAGG + Intronic
962122717 3:132579677-132579699 AATTATTATCTTAATGAATCAGG - Intronic
962515243 3:136143886-136143908 AATTGGTACCTTTTTGATGAAGG + Intronic
962729546 3:138267761-138267783 AAAATATACCTTAATGAAGAAGG + Intronic
964564864 3:158038729-158038751 CATTGGTAGCTTAATGGAGATGG - Intergenic
965566102 3:170119487-170119509 AATTACTAACTTTTTGAAGATGG + Intronic
965889278 3:173490636-173490658 CATTAGTAGCTTGATGGAGATGG + Intronic
965975620 3:174617115-174617137 ATTTAGTACCTTAAAGCAGTAGG - Intronic
967263733 3:187671581-187671603 AAATAGTTCCTTACTGAGGAAGG + Intergenic
968840108 4:2997415-2997437 AATTAGTCCCTTCATGAAAGTGG + Intronic
973013477 4:45106793-45106815 CATTGGTAGCTTAATGAGGATGG + Intergenic
974048876 4:56921257-56921279 AATTATTAACTTAAGGGAGATGG - Intronic
975126079 4:70783665-70783687 AATTATGTCCTTAATTAAGAAGG - Intronic
975337018 4:73190023-73190045 AATAAGTATTTTAATGAAAATGG - Intronic
975647583 4:76560540-76560562 AAATAGCACCTTAATGCAGAAGG - Intronic
976415613 4:84770613-84770635 ACTTAGTACCTTAATCATTATGG + Intronic
976586811 4:86807608-86807630 AACTGGTATCTTAATGAAGCTGG - Exonic
976621081 4:87127889-87127911 AATCAGGACCTTAATGATTAAGG + Intronic
976782868 4:88780507-88780529 AACTAATACATTAAGGAAGAAGG + Intronic
976804678 4:89033668-89033690 TATTAGGACCTGAATAAAGATGG + Intronic
977966865 4:103162032-103162054 AATTAATACATGAATGAATAAGG + Intronic
980213728 4:129823431-129823453 ACTAAGTTCCATAATGAAGAAGG + Intergenic
980235657 4:130101956-130101978 ACTTAGTAGCTTCATGAATATGG + Intergenic
980459344 4:133086005-133086027 AATAAATACCTTAAAGAAAAAGG + Intergenic
981272509 4:142861030-142861052 AAGTAGTGCCTCAATGAAGAAGG + Intergenic
981638933 4:146912955-146912977 AATTAGTAATTTGCTGAAGAGGG + Intronic
984224810 4:177021838-177021860 AATTGGTAGCTTGATGGAGATGG - Intergenic
984605505 4:181781164-181781186 CATTGGTAGCTTAATGAGGATGG + Intergenic
987575839 5:19726889-19726911 GATTAGTAACTTTATTAAGAAGG + Intronic
990392001 5:55332701-55332723 AATTAGTATATTCATGAAGATGG + Intronic
990590928 5:57263678-57263700 AAGTAATACCTTACTAAAGATGG + Intronic
991105895 5:62841674-62841696 AATTGGTAGCTTGATGGAGATGG - Intergenic
993649633 5:90504033-90504055 AACTAGTAGCTTAATGCAAAAGG + Intronic
994490726 5:100439952-100439974 CATTGGTAGCTTGATGAAGATGG - Intergenic
994675441 5:102815442-102815464 AACTAGTAATTTAATGCAGAAGG - Intronic
995096541 5:108241675-108241697 AAAGACTACCTTAATGAACAAGG + Intronic
995234554 5:109812697-109812719 AATTAGTCCCTTTGTAAAGATGG - Intronic
999161938 5:149508692-149508714 AATTAGTACATTAAGGAACAGGG - Intronic
999797563 5:155002622-155002644 TACAAGTACCTTAATGAAAATGG - Intergenic
999908614 5:156170900-156170922 AATTAGTACTTGAAAGAAGGTGG + Intronic
1000774674 5:165404328-165404350 ATTGAGTACCTAAATGAAGATGG + Intergenic
1003165471 6:3673733-3673755 CATTGGTAGCTTGATGAAGATGG + Intergenic
1003813856 6:9815216-9815238 CATTGGTAGCTTGATGAAGATGG - Intronic
1004228564 6:13811050-13811072 AATTGGCAATTTAATGAAGAAGG - Intronic
1006953132 6:37842067-37842089 AATTAGTACCTTTATAAAAGAGG - Intronic
1007493457 6:42242750-42242772 AATTAGTTCCTTAATGATGGAGG + Intronic
1008342185 6:50380850-50380872 AATTCGTATCTTACTGAAAACGG - Intergenic
1008537630 6:52518786-52518808 AATTGGTCTCTTTATGAAGAAGG - Intronic
1009987738 6:70802057-70802079 CATTGGTAGCTTGATGAAGATGG + Intronic
1010662243 6:78584597-78584619 AAGAAATACATTAATGAAGAAGG + Intergenic
1010800729 6:80172531-80172553 AAAAATTACCTTGATGAAGAGGG - Intronic
1011102565 6:83739696-83739718 AACTAGTATCTTACTGAATAGGG - Intergenic
1011855551 6:91685231-91685253 AATTAGTACCCTTATAAAAAAGG - Intergenic
1011898615 6:92263381-92263403 CATTTGCTCCTTAATGAAGATGG + Intergenic
1012080131 6:94747495-94747517 CATCAATATCTTAATGAAGATGG + Intergenic
1012827842 6:104168078-104168100 AATTAGTATCATAGTGAATAAGG + Intergenic
1014364277 6:120520920-120520942 AATTGGTAGCTTGATGAGGATGG + Intergenic
1014828769 6:126076810-126076832 AATTACTACCTGAATTAAAATGG + Intergenic
1015889444 6:137955112-137955134 AAATAGTGCCTCAATGAAAATGG - Intergenic
1016037662 6:139399844-139399866 CATTAGTCCATTAATTAAGATGG - Intergenic
1016641376 6:146353274-146353296 AATTAACACCTTCAGGAAGAAGG + Intronic
1017350039 6:153429692-153429714 AAATTATAACTTAATGAAGATGG - Intergenic
1017398421 6:154030228-154030250 TATTAATACGTTTATGAAGAAGG + Intronic
1020552715 7:9626688-9626710 ACTTAATTACTTAATGAAGAGGG - Intergenic
1020973259 7:14974750-14974772 AATTAGTACCTTACTGGCTAGGG - Intronic
1022521365 7:31009398-31009420 AATGAGAAACTTAATGGAGAAGG - Intergenic
1023652275 7:42384293-42384315 TATTAGGAAATTAATGAAGAGGG + Intergenic
1024475819 7:49808956-49808978 TATTAGTTCCTTAAGGTAGAGGG - Intronic
1025163179 7:56683689-56683711 ACTTAGAACCTTAAATAAGATGG + Intergenic
1028916559 7:96265941-96265963 GATTAGTACCTTTGTGAAGGAGG - Intronic
1031044217 7:116869445-116869467 ATTTAGTAAATGAATGAAGATGG - Intronic
1031885691 7:127243610-127243632 AATTAGTTTCTTACTGAATAGGG - Intronic
1032976031 7:137223732-137223754 ATTTTGTCTCTTAATGAAGATGG - Intergenic
1038068796 8:23991115-23991137 TATTAGTAACTTTAGGAAGAAGG + Intergenic
1038592310 8:28851060-28851082 AAGTAAAAGCTTAATGAAGAAGG + Intronic
1039192113 8:34987967-34987989 AATTAGAATTTTAATGTAGAAGG - Intergenic
1039617022 8:38963917-38963939 ATTTAGTAATTTAGTGAAGACGG - Intronic
1042853107 8:73236392-73236414 CATTGGTAGCTTAATGCAGATGG + Intergenic
1043363898 8:79509237-79509259 AATTAGCACCTTAATGTATTTGG - Intergenic
1043656835 8:82677643-82677665 AATTAGTAGCATTTTGAAGAGGG - Intergenic
1045175538 8:99720399-99720421 AATGGATACCTTAATGAGGAGGG + Exonic
1046132237 8:109980396-109980418 AATGAGTTCCTTAATAATGAAGG - Intergenic
1048084836 8:131165750-131165772 AATTTGTAGCTTAATGAAAGAGG - Intergenic
1051055176 9:12977119-12977141 GCTTAGTACCTTTATGAAAAAGG - Intergenic
1051586101 9:18728589-18728611 AAATAGTAACTTTATGAATAGGG + Intronic
1057901544 9:98952980-98953002 AATTCGTGGCTTAATGAAGGAGG - Intronic
1186875629 X:13814636-13814658 TATGTGTACCTTAATGATGATGG + Intronic
1187441611 X:19325834-19325856 AATGCTTACCTAAATGAAGATGG + Intergenic
1187699275 X:21949230-21949252 CATTAGCACCTTCATGGAGAGGG - Intronic
1187831344 X:23385154-23385176 AATTAGTCCCATAATGACCATGG - Intronic
1188132084 X:26448566-26448588 AATGAGGACTATAATGAAGAGGG - Intergenic
1189124500 X:38431963-38431985 ACTTAGTACCTTATTAATGAAGG - Intronic
1190895902 X:54617692-54617714 GATTAGTACCTTTATGAAAGAGG + Intergenic
1193013241 X:76701972-76701994 AATTAGTATCATACTGAATAAGG + Intergenic
1193955819 X:87860763-87860785 AAGTTGTACTATAATGAAGAGGG + Intergenic
1194195943 X:90892946-90892968 AATTAGTACCTTATTCCAGGAGG + Intergenic
1196552039 X:117040188-117040210 AGTTAGTATATGAATGAAGAAGG - Intergenic
1198162828 X:134024474-134024496 AATTAGTCCCATAATTATGAAGG + Intergenic
1198978669 X:142367640-142367662 AATTGGTATCTTATTGAAAATGG + Intergenic
1200541791 Y:4467138-4467160 AATTAGTACCTTATTCCAGGAGG + Intergenic
1201353867 Y:13076345-13076367 CATTGGTAGCTTAATGAGGATGG - Intergenic
1201895365 Y:18986749-18986771 AAAAAGTCCATTAATGAAGAAGG + Intergenic
1201912969 Y:19152205-19152227 AATTAACACATTAATGAAGAGGG - Intergenic
1202087836 Y:21157384-21157406 CATTGGTACCTTGATGCAGATGG + Intergenic