ID: 1091974023

View in Genome Browser
Species Human (GRCh38)
Location 12:4810543-4810565
Sequence GAGAGCTCTGGGCCGGCCAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 243}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091974012_1091974023 16 Left 1091974012 12:4810504-4810526 CCCTTCCAGCGCCAGGTGTGGCT 0: 1
1: 0
2: 3
3: 93
4: 277
Right 1091974023 12:4810543-4810565 GAGAGCTCTGGGCCGGCCAGGGG 0: 1
1: 0
2: 1
3: 16
4: 243
1091974010_1091974023 20 Left 1091974010 12:4810500-4810522 CCAGCCCTTCCAGCGCCAGGTGT 0: 1
1: 1
2: 5
3: 26
4: 298
Right 1091974023 12:4810543-4810565 GAGAGCTCTGGGCCGGCCAGGGG 0: 1
1: 0
2: 1
3: 16
4: 243
1091974007_1091974023 24 Left 1091974007 12:4810496-4810518 CCTCCCAGCCCTTCCAGCGCCAG 0: 1
1: 0
2: 5
3: 67
4: 518
Right 1091974023 12:4810543-4810565 GAGAGCTCTGGGCCGGCCAGGGG 0: 1
1: 0
2: 1
3: 16
4: 243
1091974006_1091974023 25 Left 1091974006 12:4810495-4810517 CCCTCCCAGCCCTTCCAGCGCCA 0: 1
1: 0
2: 2
3: 63
4: 510
Right 1091974023 12:4810543-4810565 GAGAGCTCTGGGCCGGCCAGGGG 0: 1
1: 0
2: 1
3: 16
4: 243
1091974014_1091974023 11 Left 1091974014 12:4810509-4810531 CCAGCGCCAGGTGTGGCTGCTCT 0: 3
1: 0
2: 2
3: 23
4: 362
Right 1091974023 12:4810543-4810565 GAGAGCTCTGGGCCGGCCAGGGG 0: 1
1: 0
2: 1
3: 16
4: 243
1091974013_1091974023 15 Left 1091974013 12:4810505-4810527 CCTTCCAGCGCCAGGTGTGGCTG 0: 1
1: 0
2: 4
3: 24
4: 252
Right 1091974023 12:4810543-4810565 GAGAGCTCTGGGCCGGCCAGGGG 0: 1
1: 0
2: 1
3: 16
4: 243
1091974009_1091974023 21 Left 1091974009 12:4810499-4810521 CCCAGCCCTTCCAGCGCCAGGTG 0: 1
1: 0
2: 4
3: 30
4: 319
Right 1091974023 12:4810543-4810565 GAGAGCTCTGGGCCGGCCAGGGG 0: 1
1: 0
2: 1
3: 16
4: 243
1091974015_1091974023 5 Left 1091974015 12:4810515-4810537 CCAGGTGTGGCTGCTCTTTGAGT 0: 1
1: 2
2: 0
3: 16
4: 173
Right 1091974023 12:4810543-4810565 GAGAGCTCTGGGCCGGCCAGGGG 0: 1
1: 0
2: 1
3: 16
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091974023 Original CRISPR GAGAGCTCTGGGCCGGCCAG GGG Exonic
900071183 1:772328-772350 AAGGGCTCTAGGCTGGCCAGAGG + Intergenic
900173518 1:1281823-1281845 AAGAGCCCAGGTCCGGCCAGTGG - Intronic
900545783 1:3228494-3228516 GGGAGCTCTGGGCCAGCCCCAGG + Intronic
901712953 1:11130103-11130125 CGGATCTCTGGGCCTGCCAGCGG + Intronic
901737529 1:11321966-11321988 GGGTGCTCTGGGCAGGGCAGGGG - Intergenic
902777133 1:18682297-18682319 GAGGCCTCTGGGGCAGCCAGAGG + Intronic
904858422 1:33517266-33517288 GAGACCTGTGGGCTGGGCAGTGG + Intronic
905118973 1:35667117-35667139 GAGAGCTCTGGAGAGGGCAGAGG - Intergenic
905689680 1:39933759-39933781 GAGAGCTCTGGGAATCCCAGAGG + Intergenic
907439902 1:54472726-54472748 GGGAGCCATGGGCTGGCCAGAGG + Intergenic
911144771 1:94541704-94541726 AGGCGCCCTGGGCCGGCCAGAGG + Exonic
912435505 1:109658325-109658347 GGCAGCTCAGGGGCGGCCAGAGG + Intronic
912576049 1:110674106-110674128 GAGAGCTCCGGGCCGGCCCGGGG - Exonic
914353389 1:146860026-146860048 GAGAGCTGTGGCCAGGGCAGAGG + Intergenic
916720342 1:167480446-167480468 GAGAGCTCTGGGGGTGTCAGGGG - Intronic
916786909 1:168093006-168093028 GAAGGTTCTGGGTCGGCCAGCGG + Intronic
919747265 1:201016715-201016737 CAGAGCTCTGTGACAGCCAGAGG + Intronic
920389263 1:205588853-205588875 GGGAGCTTACGGCCGGCCAGAGG + Intronic
920391877 1:205610134-205610156 TAGAACTCTGGGCCAGCCACAGG + Exonic
922116471 1:222618359-222618381 GCGACCCCCGGGCCGGCCAGGGG - Intronic
922973282 1:229761135-229761157 GTAAGCTCTGGGGCAGCCAGGGG - Intergenic
1063962092 10:11315074-11315096 GGGAGCAGTGTGCCGGCCAGAGG + Intronic
1065523468 10:26594153-26594175 AGGAGCTCTGGGTCGTCCAGGGG - Intergenic
1065557481 10:26931343-26931365 GGGAGCTCTGGGTCGTCCAAGGG + Intergenic
1066022920 10:31320099-31320121 CGGGGCTCTGGGCCGGGCAGCGG - Intronic
1067090177 10:43262433-43262455 GAGAGCTCTGGGACAGTCTGGGG - Intronic
1069581890 10:69572248-69572270 TGGAGGCCTGGGCCGGCCAGGGG + Exonic
1069901344 10:71708286-71708308 GAGGGCTCTGGGCAGGTCAGCGG - Intronic
1070547797 10:77466109-77466131 GAGAGGTCTGGGCCAGGAAGAGG - Intronic
1075095839 10:119470083-119470105 GAAAGATCGGGGCCGGCAAGGGG + Intergenic
1076278564 10:129225762-129225784 GGGAGCCCTGGGCAGGCCTGTGG - Intergenic
1077530002 11:3090590-3090612 GAGAGCTCTGGGCAGGACTCAGG + Exonic
1080020138 11:27551630-27551652 GACAGCTCTGGGCCTGCTACTGG - Intergenic
1081639072 11:44740442-44740464 GAGAGGGCAGGGCCAGCCAGGGG + Intronic
1082809877 11:57473476-57473498 GAGAGCTGTGAACCGGCCAGTGG + Intronic
1082818685 11:57528715-57528737 CAGAGCTCTGGGCCTGCATGAGG - Exonic
1084004669 11:66316634-66316656 CACAGCGCTGGGCCGGGCAGGGG + Exonic
1084192772 11:67506302-67506324 GAGAGCCCTGGGCCTTCCTGTGG - Intergenic
1085423126 11:76380847-76380869 GGGAGGGCTGGGCCGGCCGGCGG - Exonic
1087014282 11:93541363-93541385 GAGAAGTCTGGGCATGCCAGAGG + Intronic
1089776778 11:120843235-120843257 GGGAGCTCTGGCCCTGCCTGGGG - Intronic
1090520719 11:127476090-127476112 GAGAGCTCTGACCTGGACAGAGG + Intergenic
1091103473 11:132897270-132897292 GAGAGCTCTTGGCCAGCTACTGG + Intronic
1091974023 12:4810543-4810565 GAGAGCTCTGGGCCGGCCAGGGG + Exonic
1096695341 12:53345059-53345081 GAAAGGACTGGGCCGGGCAGCGG - Intronic
1100372089 12:93977815-93977837 GAGAGCTCTGTGCATGGCAGAGG + Intergenic
1102305858 12:111804064-111804086 GGGGGCTCGGGGCCTGCCAGAGG + Intronic
1102438176 12:112941577-112941599 GAGAGCTGTGCCCCGGCCCGAGG - Exonic
1103565265 12:121812121-121812143 GGAAGCTCCGGGCCGGCCCGCGG + Intronic
1104744859 12:131204335-131204357 GGCAGCTCTGGGCTGGCCGGGGG - Intergenic
1106022297 13:25926949-25926971 GAGAGCCCTGGGAGGGCCACAGG + Intronic
1106099078 13:26679098-26679120 GAGAGGACTGGGAGGGCCAGAGG - Intronic
1106397864 13:29398540-29398562 GAGACATCTGGGCTGGGCAGTGG - Intronic
1107371630 13:39756729-39756751 AAGAGCTCTGGGCGGGGCGGGGG + Intronic
1108829769 13:54463062-54463084 GAGAACTCTGGGGCAGGCAGGGG - Intergenic
1117500306 14:56344675-56344697 GGGAGCTCAGGGCTGGGCAGAGG - Intergenic
1118610028 14:67532965-67532987 GAGAGCTCCGGGCCGGCGCCCGG + Intronic
1118656029 14:67949851-67949873 CAGAGCTCTTGGGTGGCCAGGGG + Intronic
1121479168 14:94247414-94247436 GAGATCCCTGGGCAGGGCAGTGG - Intronic
1121902414 14:97706156-97706178 GAGAGCTCTGGGCTGGTGACAGG - Intergenic
1122326760 14:100885308-100885330 CAGAGCCCTGAGCCTGCCAGGGG - Intergenic
1122421378 14:101579587-101579609 GAGAGGTCTGGGCTGGGCATTGG + Intergenic
1122470918 14:101965177-101965199 GGGGGCTCCGGGCCGGGCAGTGG - Intronic
1122502776 14:102212376-102212398 GAGAGCACTGTGCCAGCCTGGGG + Intronic
1122910666 14:104826406-104826428 GAGAGCTTGGGGCTGGCCACGGG - Intergenic
1124454804 15:29832218-29832240 GAGAGCCCTGGGCCTACCACAGG + Intronic
1128087788 15:64897745-64897767 CAGACCTCTAGGCCAGCCAGAGG + Intronic
1128322707 15:66704078-66704100 GAGCGCGCTGCGCCGGCCGGGGG + Intronic
1128488134 15:68117518-68117540 GAGAACTCTGGGGAGGACAGAGG - Intronic
1129446983 15:75625574-75625596 CAGAGTGCAGGGCCGGCCAGAGG + Exonic
1132153728 15:99480555-99480577 GAGAGGGCTGGGCAAGCCAGGGG - Intergenic
1132367649 15:101269176-101269198 GACAGCTCTGGGCACCCCAGGGG + Intergenic
1133232677 16:4373889-4373911 ATGAGCTCAGGGCTGGCCAGTGG - Intronic
1137406874 16:48196202-48196224 GAGAGCCCTGGGCTGGCATGGGG + Intronic
1138504704 16:57472465-57472487 GAGTGCTTTTGGCTGGCCAGAGG + Exonic
1139545496 16:67647850-67647872 GAGGGCTCTGGGCCGGGCACTGG + Exonic
1139980634 16:70855492-70855514 GAGAGCTGTGGCCAGGGCAGAGG - Intronic
1140207752 16:72947584-72947606 GAGAGGTCTGGGAGGGCCACCGG + Intronic
1141677465 16:85525158-85525180 GAAACCACTGGGCCGGCCAGGGG - Intergenic
1142273394 16:89102809-89102831 GAGAGCCCTGGCCCCGACAGGGG - Intronic
1142659035 17:1414922-1414944 CAGAGCTGTGGCCTGGCCAGCGG + Intergenic
1143324476 17:6089802-6089824 CAGAGCTCAGGGCTGGCAAGAGG + Intronic
1144658229 17:17051671-17051693 GAGAGCTCTGGGTAGGGCATGGG - Intronic
1144692212 17:17275023-17275045 GAGAGCTATGGGCTGGCTGGAGG - Intronic
1144726689 17:17505897-17505919 CAGAGCTCTGGTGCGGGCAGTGG - Intronic
1144969150 17:19096251-19096273 GAGATCTCTGGACCAACCAGTGG + Intronic
1144978766 17:19155815-19155837 GAGATCTCTGGACCAACCAGTGG - Intronic
1144989456 17:19222417-19222439 GAGATCTCTGGACCAACCAGTGG + Intronic
1145254142 17:21313638-21313660 GAGAACACAGGGCCAGCCAGAGG - Intronic
1146668515 17:34720914-34720936 GAGGGCACTGGGCCAGGCAGAGG + Intergenic
1147046358 17:37755239-37755261 GAGAGGCCTGGCCAGGCCAGGGG - Intergenic
1148244427 17:46021214-46021236 GAGAGCTCTCGGCCAGCTACGGG - Intronic
1148495006 17:48048370-48048392 CCGAGCTCTAGGCCGGCCGGCGG + Exonic
1148562301 17:48613097-48613119 GAGAGCTCTGGCCCCGCTAGCGG - Exonic
1148683064 17:49485814-49485836 GGGCACTCTGGGCGGGCCAGGGG - Intergenic
1148765479 17:50036250-50036272 GAGAGCTTGGGGCTGGGCAGAGG - Intergenic
1148765537 17:50036523-50036545 GAGAGCTTGGGGCTGGGCAGGGG + Intergenic
1150131190 17:62670134-62670156 GAGAGATATGGGCTGGGCAGAGG - Intronic
1150335206 17:64326025-64326047 GAGGGCTCTGGGCTGGGCAGTGG + Intronic
1151993427 17:77593316-77593338 GAGATTTCTGGGCCACCCAGGGG - Intergenic
1152193617 17:78903269-78903291 GACAGCTGTGAGCCAGCCAGGGG + Intronic
1152233478 17:79126386-79126408 GAGGGCTGTGGGCCGGGCAGGGG - Intronic
1152408908 17:80112215-80112237 GAGAGCACTCGGGCCGCCAGCGG - Intergenic
1152528560 17:80903444-80903466 GAGAGGCCTGGGCAGGCCTGGGG - Intronic
1152608109 17:81303074-81303096 TGGTGCTCTGGGCCGGGCAGGGG + Intergenic
1152648734 17:81482215-81482237 GAGGGCTGTGGTCCGGGCAGGGG + Intergenic
1152763492 17:82122177-82122199 GAGAGCCCGAGGCCGGCCACAGG - Intronic
1153230070 18:2926687-2926709 GAGTGCTATGAGCCGGGCAGAGG + Intronic
1156457538 18:37303196-37303218 GTGGGCTCTGGGCCTCCCAGGGG - Intronic
1157310906 18:46552569-46552591 GAGAGCTCTGTGTGGTCCAGGGG - Intronic
1157338233 18:46756728-46756750 GGGAGCTCTGCCGCGGCCAGGGG + Exonic
1157566595 18:48682804-48682826 GACAGCCCTGGGCGGGCCATTGG + Intronic
1157867372 18:51197794-51197816 GAGAGCTCTGGGGAGGGGAGGGG - Intronic
1160345933 18:78131741-78131763 GAGAGCTCGGTGCCTGCCACAGG - Intergenic
1160652253 19:237288-237310 AAGGGCTCTAGGCTGGCCAGAGG + Intergenic
1160736248 19:663575-663597 GAGAGCGCTGCACCGGGCAGCGG - Intergenic
1160930189 19:1566765-1566787 GAGAACAATGGGGCGGCCAGAGG + Intronic
1160957058 19:1698670-1698692 GAGGGCTGAGGGCCAGCCAGAGG - Intergenic
1161478938 19:4501175-4501197 GAGAGATCTGGGTGGGACAGAGG - Exonic
1161545110 19:4875805-4875827 GGGGGCTCTGGGAGGGCCAGTGG + Intergenic
1161560759 19:4971331-4971353 GAGCCCTCTGGGGTGGCCAGGGG + Intronic
1162478957 19:10916875-10916897 GAGAGCGCTGTGCAGGGCAGAGG - Intronic
1162505784 19:11084037-11084059 GAGACCTCGGTGCCTGCCAGTGG - Intergenic
1162923662 19:13918896-13918918 GGCACCTCTGGGCCGGACAGGGG - Exonic
1163678153 19:18665816-18665838 GAGAGAGCTGGGCCGCCCTGGGG + Intronic
1163721359 19:18899661-18899683 GACAGCTCTGGGCCAGCCTCAGG + Exonic
1163747618 19:19057588-19057610 GAGAGCTGTGGACAGGCCAGAGG + Exonic
1164374347 19:27672387-27672409 GAGGACTCTGGGCCGACCACAGG - Intergenic
1164500508 19:28815476-28815498 TAGAGCTCTGGGCCTGTGAGGGG + Intergenic
1165923608 19:39313995-39314017 CAGGCCTCTGGGCTGGCCAGCGG + Exonic
1166706867 19:44912931-44912953 GGAAGCTCTGAGCTGGCCAGAGG + Intergenic
1166709039 19:44925486-44925508 GGAAGCTCTGAGCTGGCCAGAGG + Intergenic
1168462043 19:56567526-56567548 GGGAGGTCTGGGCGGGGCAGCGG + Exonic
925277840 2:2662857-2662879 GAGGGCTCAGGGCCTCCCAGGGG - Intergenic
927095576 2:19745563-19745585 GTAAGCTCTGGGATGGCCAGTGG + Intergenic
928174145 2:29022858-29022880 CAGAGCTGAGGGCTGGCCAGAGG + Intronic
928954070 2:36843313-36843335 GTGAGTTCTGGGCAGGCCAAAGG + Intergenic
931457701 2:62425019-62425041 GAGGGCTGAGGGCCAGCCAGTGG - Intergenic
931516612 2:63053953-63053975 CCGAGATCTGGGCCTGCCAGGGG + Intronic
932757473 2:74418256-74418278 GAGACCTCGGGGCCGACCAAAGG - Intronic
932976872 2:76613333-76613355 AAGAGCTCTGAGCCAGACAGAGG + Intergenic
936161331 2:110086120-110086142 CAGAGTTCTGGGCCAGCGAGGGG - Intronic
936183332 2:110285234-110285256 CAGAGTTCTGGGCCAGCGAGGGG + Intergenic
936241015 2:110788877-110788899 GTGAGCTCTGGGTCAGTCAGGGG + Intronic
937040329 2:118815821-118815843 CACACCTCTGGGCCTGCCAGAGG - Intergenic
942674580 2:178413625-178413647 GAGGGGTGTGGGCCGCCCAGAGG - Intergenic
946399178 2:219459851-219459873 GAGGGCTGGGGGCCGGGCAGAGG - Intronic
947665701 2:231904226-231904248 AAGAGCTCTGGGCCGGCAGGCGG - Intergenic
947710740 2:232314109-232314131 GAGCCCTCTGGGCCTGCCTGTGG + Intronic
948366615 2:237459238-237459260 GTTAGTTCTGGGCAGGCCAGTGG + Intergenic
1170647929 20:18213294-18213316 GAGAACTCAGGGCAGGGCAGGGG - Intergenic
1170945457 20:20887564-20887586 GACTGCTCTGGGCTGGACAGAGG + Intergenic
1171974785 20:31587697-31587719 GGCAGCTCTGGGCTGGCCGGGGG - Intergenic
1174198368 20:48789403-48789425 GAGAGCTCAGGATGGGCCAGTGG + Intronic
1175215387 20:57389662-57389684 GAAAGCTCTGGCCCAGCCGGAGG - Intergenic
1175926288 20:62473207-62473229 GAGCGCTCAGGGCAGGGCAGGGG - Intronic
1176137906 20:63532926-63532948 CAGAGGTCTGGGCCGGGCACAGG - Intronic
1177932861 21:27306289-27306311 AAGACCCCTGGGCAGGCCAGTGG - Intergenic
1178718618 21:34988978-34989000 GAGAGATCTGGGCCAGCCAAAGG - Intronic
1178843683 21:36157148-36157170 GAGAGCTCGGGGCCGGAGACCGG + Intronic
1179918763 21:44495615-44495637 GACAGCTCTGGACAGCCCAGAGG + Intergenic
1180036324 21:45252239-45252261 GACAGCCCTGGGCCCGCAAGAGG - Intergenic
1180051884 21:45335283-45335305 GAGGGCACTGGCCCGGCGAGGGG - Intergenic
1180163063 21:46006684-46006706 GAGGGCTCAGGGCCGGCTCGGGG - Intergenic
1180622478 22:17171480-17171502 GGGAGCTCTGTGCCGTCCCGCGG + Intergenic
1181518838 22:23433804-23433826 GGGGGCTCTGGGGCAGCCAGGGG + Intergenic
1181600877 22:23951302-23951324 GAGCCCCCTGGGCAGGCCAGAGG + Intergenic
1181607636 22:23990024-23990046 GAGCCCCCTGGGCAGGCCAGAGG - Intergenic
1182066332 22:27434118-27434140 CAGAGCCCTGGGCAGGCAAGGGG + Intergenic
1182257725 22:29050402-29050424 GAGGGCTCTGGCCCGGCGGGTGG + Exonic
1182465190 22:30511303-30511325 GATAGCTCAGGGCTGTCCAGTGG + Intergenic
1182617827 22:31600425-31600447 CGGAGCTCTGGCCCAGCCAGAGG - Intronic
1182725961 22:32445812-32445834 GAGAGCCCTGGGTTGGGCAGTGG - Intronic
1183306100 22:37084069-37084091 GAGACCTCTGGGGTAGCCAGAGG + Intronic
1183504751 22:38202770-38202792 GCGTGCCCTGGGCCGGCCACCGG + Intronic
1184071444 22:42150019-42150041 AAGAGCTCTATGCGGGCCAGGGG + Intergenic
1184250374 22:43256801-43256823 GAGAGCCCCAGGCCGGACAGTGG + Intronic
950579454 3:13852927-13852949 GAGAGCACTGGGCAGGCAGGAGG + Intronic
954325322 3:49860357-49860379 TAGAGCTCAGGGCAGCCCAGAGG - Intronic
954645362 3:52128143-52128165 GTGAGCTCTGGGCAGGCAAAAGG - Intronic
957392578 3:79596241-79596263 GAGAGCTCTGTGCCAGACAGGGG + Intronic
959997860 3:112698328-112698350 GAGAGCTCTTGGCCTGCTACTGG + Intergenic
961678221 3:128581212-128581234 GAGAGCCCTGGACAGGCCACAGG - Intergenic
961801332 3:129452404-129452426 GAGAGTGCTGGGCAGGGCAGGGG + Intronic
962391346 3:134975307-134975329 GAGAGCCTTGGGCAGGGCAGGGG + Intronic
964373811 3:156029814-156029836 GAGAGCTCTGGCCCCTACAGTGG - Intergenic
967882972 3:194314623-194314645 GACAGCTCTGGGCCAGGCACGGG + Intergenic
968003159 3:195221534-195221556 CAGGGCTCTAGGCTGGCCAGAGG - Intronic
968051579 3:195658302-195658324 GAGAGCCCTGGGCCGGTGCGAGG + Intergenic
968104237 3:195990031-195990053 GAGAGCCCTGGGCCGGTGCGAGG - Intergenic
968302538 3:197627621-197627643 GAGAGCCCTGGGCCGGTGCGAGG - Intergenic
968541653 4:1171240-1171262 GTGAGCGCGGGGCCGGCCGGGGG - Intronic
968701456 4:2059920-2059942 GGGAGCTCCGCGCCGGCCCGAGG - Intronic
969297977 4:6280770-6280792 GAGAGCTCAGGGCCGCATAGTGG - Intronic
969373083 4:6746585-6746607 GGGAGTTCTGGGCCGTCCACCGG + Intergenic
969608523 4:8214248-8214270 GTGAGCTCTGGGAAGGGCAGGGG + Intronic
969847797 4:9933317-9933339 GAGGCCACTGGGCAGGCCAGTGG + Intronic
970069170 4:12136831-12136853 AAGAGCTCTGGGTCCACCAGTGG + Intergenic
971396763 4:26235661-26235683 GAGAGCTCTGGAACAGCTAGAGG - Intronic
975714596 4:77193526-77193548 GAAAGCCCTGGGGCGTCCAGAGG + Intronic
981073553 4:140569130-140569152 GAAAGCCCTGGGCCGGCCGCTGG + Intergenic
983373568 4:166896434-166896456 GAAAGCTTTGGGCCTGCCTGGGG + Intronic
985394274 4:189525498-189525520 GAGAGCCCTGGGCCCGCCCCAGG - Intergenic
985497642 5:218555-218577 GAGAGCCCTGGGCCGGTGCGAGG + Intronic
986693171 5:10330706-10330728 GAGAGCTCTGGGTGTGACAGAGG + Intergenic
987258434 5:16179999-16180021 GTGAGCGCGGGGCCGGCCCGTGG - Intronic
988930951 5:36035157-36035179 GAGAGTTCAGGGCCGGACACAGG - Exonic
993701481 5:91123975-91123997 GAGAGCGAAGGGCAGGCCAGTGG + Intronic
997265171 5:132490990-132491012 GAGCGCTCGGGGCGGGCCCGCGG - Intergenic
998435986 5:142109090-142109112 GAGAGGCCTGAGGCGGCCAGCGG - Intronic
999282138 5:150372832-150372854 GAGTGCTCTGGGCTGGCCTTGGG + Intronic
999478663 5:151925028-151925050 TATGGCTCTGGGCCGGCCTGAGG + Intergenic
999991965 5:157058139-157058161 GAGAGCTCTGTGCCTTCCAAAGG + Exonic
1000040191 5:157479596-157479618 GAGAGCTCTGAGCAGGTGAGGGG - Exonic
1000422870 5:161058029-161058051 GAGAGCTCTTGGCCTGCTACTGG - Intergenic
1002469844 5:179428763-179428785 GAGAGCATGGGGCCGGCCAGTGG - Intergenic
1003330099 6:5122620-5122642 GAAAGCACTGGGTCGGCGAGAGG - Intronic
1006326746 6:33360072-33360094 GAGAGCCATGGGCCTGCCATGGG + Intergenic
1006473792 6:34242741-34242763 GAGACCTCGGGGCCGACCAAAGG + Exonic
1007724280 6:43905462-43905484 CAGAGCTCTGGACCAGCCAGGGG - Intergenic
1018254191 6:161902205-161902227 GCGAGGACGGGGCCGGCCAGGGG - Intronic
1019294162 7:265225-265247 GTCAGCTCTGGCCCGGCTAGTGG - Intergenic
1019599722 7:1875137-1875159 GGGGGCTCTGGGGCAGCCAGGGG - Intronic
1019917874 7:4144998-4145020 GGGAGGCCTGGGGCGGCCAGTGG + Intronic
1022339822 7:29457389-29457411 GGGAGCTCTGAGACGGCCTGGGG - Intronic
1022874331 7:34513120-34513142 GAGAGCCCTGGGCCTGCCTCAGG + Intergenic
1026134541 7:67647716-67647738 GCAAGCTCTGGGCCTGGCAGAGG + Intergenic
1026669003 7:72370757-72370779 GAGAGCTCTTGGCTGGGCATGGG + Intronic
1027052947 7:75031205-75031227 GGGGGCTCTGGGCAGGGCAGAGG - Intronic
1027229158 7:76262092-76262114 GGGAGCTCTGAGCAGGGCAGTGG + Intronic
1028234253 7:88341483-88341505 GAGAGTCCTGGGCAGGCAAGTGG - Intergenic
1029170559 7:98626892-98626914 GAGAGCTCAGGGCCAGCGTGGGG + Intronic
1032024641 7:128431344-128431366 GAGAGCACTGCTCTGGCCAGTGG + Intergenic
1032582432 7:133115805-133115827 GAGGGCTCTGGGCTGGCCACAGG + Intergenic
1034511515 7:151539198-151539220 CAGAGCTCTGAGTCGGCCACAGG - Intergenic
1035046759 7:155972921-155972943 GAGAGCCCTGGGGCTCCCAGTGG - Intergenic
1035114911 7:156516545-156516567 GAGAGCCCTGGGGCGGGCTGTGG - Intergenic
1038034686 8:23677096-23677118 GAGAGCTCATGGCCTTCCAGGGG + Intergenic
1044617637 8:94158509-94158531 GAGAGCTCTGGTCCTGCAAAAGG + Intronic
1048589802 8:135810944-135810966 GAGAGCTCTGTGCAGCACAGGGG - Intergenic
1049218283 8:141417648-141417670 GAGGGCGCCGGGCCGGCCGGCGG + Intronic
1049444418 8:142623483-142623505 CAGAGCCCTGGGCAGGCCGGGGG + Intergenic
1049661031 8:143819841-143819863 GAGAGCTCTTGGCCTGCCTGGGG - Intronic
1057440443 9:95079122-95079144 GCGAGCCCAGGGCCGCCCAGTGG + Intronic
1057834624 9:98434404-98434426 CTGAGCTCTGGGCCAGTCAGTGG + Intronic
1059877079 9:118646943-118646965 GAGAGCTCTGGACCTGTCATGGG - Intergenic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1060812400 9:126617171-126617193 GTGGGCTCTGGGCTGGCTAGAGG + Intronic
1061449730 9:130661509-130661531 GAGAGCTCCGGCCCGGCCGAGGG + Intergenic
1062192839 9:135256521-135256543 GGGAGGCCTGGGCAGGCCAGAGG - Intergenic
1062230793 9:135480293-135480315 GGGAGCTTTGGCCCGGCCCGGGG + Intronic
1062306176 9:135908014-135908036 GCGAGACCTCGGCCGGCCAGGGG - Intergenic
1203552225 Un_KI270743v1:172347-172369 GAGAGATCTGGGCCGCCCCAGGG - Intergenic
1186563428 X:10637341-10637363 CAGTTCTCTGGGCCTGCCAGAGG + Intronic
1189290491 X:39881693-39881715 GGGACCTCTGGGGCGGGCAGAGG + Intergenic
1190686022 X:52873785-52873807 GAGAGATCTGGGGCAGACAGGGG + Intergenic
1194824979 X:98550710-98550732 GAGAGCTCTTGGCCAACCACTGG + Intergenic
1195544569 X:106100582-106100604 GAGAGGGCTGGGCCGGCTGGTGG + Intergenic
1196820082 X:119694433-119694455 GAGAGACCTGGGCCCGCCAGAGG + Intergenic
1198674871 X:139120787-139120809 GTGGGCTGTGGGCCAGCCAGAGG + Intronic
1198871614 X:141181464-141181486 GAGACCTCTGGCCCGGAGAGAGG + Intergenic