ID: 1091975038

View in Genome Browser
Species Human (GRCh38)
Location 12:4817513-4817535
Sequence TTAGGGTACCAGGTGAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091975038_1091975047 15 Left 1091975038 12:4817513-4817535 CCTGGCTTCACCTGGTACCCTAA 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1091975047 12:4817551-4817573 CTATCAGCCACTGCCTTTGAAGG 0: 1
1: 0
2: 2
3: 9
4: 148
1091975038_1091975048 16 Left 1091975038 12:4817513-4817535 CCTGGCTTCACCTGGTACCCTAA 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1091975048 12:4817552-4817574 TATCAGCCACTGCCTTTGAAGGG 0: 1
1: 0
2: 0
3: 9
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091975038 Original CRISPR TTAGGGTACCAGGTGAAGCC AGG (reversed) Intronic
903131865 1:21284745-21284767 GTGGGGAGCCAGGTGAAGCCAGG + Intronic
903885660 1:26539756-26539778 TTAGGGTACCACGTGCACCTAGG - Intronic
904639126 1:31909378-31909400 TAAGAGTCCCAGGTGAGGCCAGG + Intronic
905387761 1:37616059-37616081 TCAGGGAACCAGATGAAGGCTGG + Intronic
907531526 1:55103217-55103239 CTAGTGAACCAGGTGAAGCAAGG - Intronic
908136946 1:61143019-61143041 TTATGTAAACAGGTGAAGCCAGG - Intronic
916659506 1:166908665-166908687 TGAGGGTACCAGAAGAATCCAGG + Exonic
921512314 1:216047284-216047306 GAAGGGTACCAGGTAAACCCTGG + Intronic
1063968931 10:11367897-11367919 TCAGGGTTCCAGGGGAGGCCTGG - Intergenic
1064645752 10:17457364-17457386 TTAGGGTTGCAAGTCAAGCCTGG - Intergenic
1066416039 10:35222990-35223012 TTAGAGGACCCGGTTAAGCCAGG + Intergenic
1069471165 10:68690939-68690961 TTCGGGGACCAGGAGAAGCCTGG - Exonic
1070554346 10:77516396-77516418 ATAGGGAAACAGGAGAAGCCAGG - Intronic
1071805723 10:89118566-89118588 TTAGAGAACCAGGTGAAAGCAGG - Intergenic
1077506394 11:2931734-2931756 TTTGGAAACCAGGTGAGGCCAGG + Intergenic
1077635819 11:3840883-3840905 GGAGGGCACCAGGTGAGGCCCGG - Exonic
1078444600 11:11394815-11394837 TTACGGTGCCAGGGAAAGCCAGG - Intronic
1079535139 11:21505081-21505103 TGTGGGTATCATGTGAAGCCCGG + Intronic
1082784319 11:57308622-57308644 TTGGGGCTCCAAGTGAAGCCAGG - Exonic
1084659642 11:70539264-70539286 TTTGGGCACCAGGTCATGCCAGG - Intronic
1089484523 11:118834880-118834902 TAAGGGTACAAGGTGAATCGTGG + Intergenic
1090194113 11:124800287-124800309 TCAGGCCACCAGGAGAAGCCGGG + Exonic
1091890472 12:4049896-4049918 CTATGGTGCCAGGTGAGGCCAGG - Intergenic
1091975038 12:4817513-4817535 TTAGGGTACCAGGTGAAGCCAGG - Intronic
1093999802 12:25682917-25682939 TTGGAGTAACAGGGGAAGCCTGG + Intergenic
1094009806 12:25795408-25795430 TTAAGGTAACAGGGGAAGGCAGG - Intergenic
1100240446 12:92705888-92705910 GTAGGGTACCTGGTGATGTCTGG + Intronic
1104030835 12:125065170-125065192 TTAGGGCAGCCGGAGAAGCCAGG - Intergenic
1106141914 13:27018950-27018972 TTCGTGTTTCAGGTGAAGCCTGG - Intergenic
1109426094 13:62167869-62167891 TGAGGGGACCAGGAGAAGGCGGG + Intergenic
1110281554 13:73699559-73699581 TTTGGTTACCAGGTGAAGTATGG - Intronic
1110937462 13:81309037-81309059 TTAGGGTACCTGGGGAAGATTGG + Intergenic
1111412123 13:87891018-87891040 TTCGGGGACCAGGAGAAGCCTGG + Intergenic
1122478481 14:102029112-102029134 TCAGACTACCAGGGGAAGCCAGG - Intronic
1125720606 15:41843415-41843437 TTGGGGTCCCAGGTGCAGACAGG - Intronic
1129029337 15:72607297-72607319 TTAGGGTAGCAGATGATGCAGGG - Intergenic
1129749025 15:78047482-78047504 TTAGGGTTCCAGGAGATGCCTGG + Intronic
1129828932 15:78654420-78654442 TAAGTGTATCAGGTAAAGCCTGG + Intronic
1130653728 15:85777320-85777342 TCAGGAAAGCAGGTGAAGCCAGG - Intronic
1131168254 15:90158336-90158358 TTAGGGTGCTGGGTGGAGCCTGG + Intergenic
1134002679 16:10794882-10794904 TGAGGGTTCCAGGGGCAGCCTGG - Intronic
1136456050 16:30380249-30380271 TTAAGAGACCAGGAGAAGCCTGG + Intronic
1137523879 16:49216758-49216780 GCAGGGCACCAGGTGTAGCCAGG + Intergenic
1137761657 16:50945766-50945788 TGAGGGTACCAGGAAAAGCGTGG - Intergenic
1138126609 16:54443915-54443937 TAGGGGTACAAGGGGAAGCCTGG + Intergenic
1139084797 16:63571702-63571724 TTAAGGTACCAGGTTTAGTCAGG - Intergenic
1140483211 16:75273853-75273875 TTAGGGGCCCAGGTGAAGGTGGG - Intergenic
1140491838 16:75343593-75343615 TCAGGGCACCTGGGGAAGCCTGG + Intronic
1142908911 17:3070509-3070531 TTAGGGAACTAGCTGATGCCAGG + Intergenic
1142925654 17:3233733-3233755 TTAGGGAACTAGCTGATGCCAGG - Intergenic
1144443565 17:15305639-15305661 TCAGGGTTCCTGTTGAAGCCAGG - Intronic
1145900417 17:28487296-28487318 TCAGGGTAGCAGGTGAAAGCTGG + Intronic
1153944802 18:10009256-10009278 TTAGGGTGCCAGATGAATGCAGG - Intergenic
1158925572 18:62255100-62255122 TTAGAGTAACAGGAGAAACCAGG - Intronic
1160109063 18:76007768-76007790 TTAGGGAACCAGGTGATCGCTGG + Intergenic
1160340445 18:78084830-78084852 TTAGAGTGCAAGGTGAATCCTGG + Intergenic
1160851098 19:1193106-1193128 CTGGGGTTTCAGGTGAAGCCTGG - Intronic
1160871288 19:1279018-1279040 CGAGGGTCCCAGGTGAAGACTGG + Exonic
1161951590 19:7470762-7470784 TTAGGGCACCAGGAGGGGCCAGG + Exonic
1165016293 19:32882653-32882675 TTAGGTTACCAGTTGATGCAGGG - Intronic
1166517752 19:43460214-43460236 TTAGTAAACCAGATGAAGCCGGG + Intergenic
1166668179 19:44694130-44694152 TTAGGGTCCCAAGAGAACCCTGG + Intergenic
929484442 2:42341387-42341409 TTGGGGTACCAAGTGAGGCATGG - Intronic
936450695 2:112631925-112631947 CTGGGGTACCAGGTGGAGTCTGG - Intergenic
939932882 2:148255714-148255736 TTAGAGCACCAGGTCCAGCCTGG + Intronic
944784829 2:203058721-203058743 AGAGGGTACCAGATGAAGCGTGG - Intronic
945809010 2:214525265-214525287 TGAGGGGACCAGGAGAAGACAGG + Intronic
946053395 2:216881956-216881978 CTAGGTTCCCAGGTAAAGCCTGG + Intergenic
948367356 2:237465890-237465912 TTGGGGGTCCAGGTGGAGCCAGG - Intergenic
1169974097 20:11303915-11303937 CTAGGGTACAAGGAGAAGCAAGG - Intergenic
1170237496 20:14123481-14123503 CTAGGTGACCAGGTGAAGCATGG - Intronic
1173701504 20:45075855-45075877 TTTGAGTCCCAGGAGAAGCCTGG + Exonic
1178950544 21:36981726-36981748 TTAGGGTAGCAGGAGAAGTCTGG - Intronic
1179983791 21:44910288-44910310 TTCTGGCACCAGGTGCAGCCGGG + Exonic
1180590631 22:16934174-16934196 CTAGGGTCCCAGGTCAAACCAGG + Intergenic
1180974726 22:19842053-19842075 TTCTGGTTCCAGGTGTAGCCTGG - Intronic
1181407439 22:22694883-22694905 TAATGGTACCAGCAGAAGCCAGG + Intergenic
949314318 3:2734702-2734724 TTGGGGATCTAGGTGAAGCCTGG - Intronic
951520443 3:23606279-23606301 GAAGGAAACCAGGTGAAGCCTGG + Intergenic
953637701 3:44676724-44676746 TTCGTGTACCAGGTTAACCCTGG + Intergenic
955968705 3:64414926-64414948 TTTGGGCACCTGGTAAAGCCTGG + Intronic
961439128 3:126941910-126941932 TTAGGGTAGCAGGTGAAGTGTGG - Intronic
962813444 3:138978017-138978039 TTTGGGAAACATGTGAAGCCAGG - Intergenic
962863660 3:139428222-139428244 TTCTAGTAACAGGTGAAGCCAGG - Intergenic
966770340 3:183498430-183498452 TTAGGGTCCCAGGGAGAGCCAGG + Intronic
967861939 3:194159095-194159117 GGAGGGGACCAGGTGGAGCCAGG + Intergenic
970371485 4:15411683-15411705 TTACTATACCAGGGGAAGCCAGG - Intronic
970399675 4:15705125-15705147 CTCGGGGACCAGGTGAGGCCAGG - Intronic
972427381 4:38946466-38946488 TAAGGTTGCCAGGTGAAGACAGG + Intergenic
972533851 4:39983345-39983367 TTAGAGTACAAGGAGAAGCAGGG + Intergenic
976360978 4:84177751-84177773 TTATGGTCCCAGGTAAAGCTAGG - Intergenic
982219250 4:153110881-153110903 TAAAGGCACCAGGTGAAGGCCGG + Intergenic
987685914 5:21200780-21200802 TGAGGAAAACAGGTGAAGCCTGG - Intergenic
987831768 5:23104626-23104648 TCAGGGTCCCAGGTGATCCCAGG - Intergenic
989210675 5:38855981-38856003 TTAGGGAACGAGGAGGAGCCAGG - Intronic
995077597 5:108005272-108005294 TCAGAGTCCCAGGTGAGGCCAGG + Intronic
1001648043 5:173296868-173296890 CTAGGGTAGCAGGTGGAGCAGGG + Intergenic
1010911734 6:81566607-81566629 TTAAAGTGCCAGGTGCAGCCTGG - Intronic
1011875100 6:91949443-91949465 TTAGAATAGCAGGTGAGGCCGGG - Intergenic
1012985069 6:105867017-105867039 TCAGGGTACTAGATCAAGCCTGG + Intergenic
1022060187 7:26785741-26785763 TTTGGGTATCAGATGGAGCCAGG - Intronic
1023776084 7:43609035-43609057 TCAGGGTGCCAGCTGAAACCAGG + Intronic
1031512242 7:122665093-122665115 TTAGGGTAAAAGTTGAGGCCAGG - Intronic
1035165885 7:156989662-156989684 TGAGGCTACCAAGTGAAGCGTGG - Intergenic
1038947859 8:32381118-32381140 TTAGGAGACCATGTGTAGCCCGG - Intronic
1040061058 8:43103121-43103143 TTAGGGTAGCAGGTGGAGGCTGG - Intronic
1041714773 8:60923177-60923199 TGAGGGCACCCGGTGAAGGCCGG + Intergenic
1042753329 8:72182473-72182495 TTAGGGTACTTGGTGATGGCAGG - Intergenic
1043008910 8:74857295-74857317 TGAGGATACGAGGAGAAGCCAGG - Intergenic
1047024061 8:120808308-120808330 TAAGTGTAACAGGTAAAGCCTGG + Intronic
1049208745 8:141375628-141375650 CCAGGGTACCAGCTGAGGCCAGG + Intergenic
1051785416 9:20737495-20737517 CGAGGTTACTAGGTGAAGCCTGG + Intronic
1052316307 9:27119507-27119529 TTAGGACACCAAGGGAAGCCAGG - Intronic
1053412222 9:37923197-37923219 TCAGTGTTCCATGTGAAGCCAGG + Intronic
1056309929 9:85330132-85330154 TTTGGGGAGCAGGTGATGCCTGG - Intergenic
1058329419 9:103740595-103740617 TAAGGGTACCAGGTGAAGAATGG - Intergenic
1191776588 X:64821394-64821416 TCAGGGTACCAGATAAACCCAGG + Intergenic
1192474854 X:71431619-71431641 TTAAGATAACAGGTGAGGCCTGG + Intronic
1193526839 X:82601144-82601166 TTAGGGTATCAGGGTAATCCTGG + Intergenic
1197046323 X:122002958-122002980 TTAGAGTACCAGGAGGAGACAGG - Intergenic