ID: 1091975918

View in Genome Browser
Species Human (GRCh38)
Location 12:4825062-4825084
Sequence CTCAAACACAAGTAGCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091975918_1091975919 -9 Left 1091975918 12:4825062-4825084 CCTTCAAGCTACTTGTGTTTGAG 0: 1
1: 0
2: 0
3: 6
4: 144
Right 1091975919 12:4825076-4825098 GTGTTTGAGCACCCTTTGTCAGG 0: 1
1: 0
2: 1
3: 8
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091975918 Original CRISPR CTCAAACACAAGTAGCTTGA AGG (reversed) Intronic
900852550 1:5155412-5155434 TTCAAACAAAAGTAGCTTTAGGG + Intergenic
900912184 1:5606308-5606330 CTCAAACCCATGTTGTTTGAGGG + Intergenic
902181031 1:14688503-14688525 TTCTAACACAAGATGCTTGAGGG - Intronic
903579804 1:24362204-24362226 CTTAAACACAGAGAGCTTGAGGG + Intronic
903845007 1:26274399-26274421 CTCAAACATAACTTTCTTGAGGG - Intronic
907626328 1:56033726-56033748 CTCAAACACATGTAACTTACAGG - Intergenic
908800667 1:67876937-67876959 CACCATCACCAGTAGCTTGATGG - Intergenic
910892050 1:92028772-92028794 TTCAAACACATGTTGTTTGAGGG - Intergenic
915497944 1:156294551-156294573 GTCAAACTCAAGCAGCTGGAGGG + Exonic
916161749 1:161923191-161923213 CTCAAAGATAATTACCTTGAAGG + Intronic
917058329 1:171008009-171008031 CCCAAACAAAAGTACCTTGCTGG - Intronic
919337451 1:196255498-196255520 CTCAAACACATCTAGCTCCAAGG - Intronic
919890872 1:201973292-201973314 CTCAAAAACAAGAAAATTGAGGG + Intergenic
922677638 1:227562313-227562335 CACAGACACAGGCAGCTTGAAGG - Intergenic
924846427 1:247777815-247777837 CTCAAACACAATTAGATAGTTGG + Intergenic
1065433142 10:25680333-25680355 CTCAAACACAGAAAGCTTGGAGG - Intergenic
1067877747 10:50020078-50020100 CACAAACACAAGTGGAGTGAGGG - Intergenic
1067877765 10:50020145-50020167 CACAAACACAAGTGGAGTGAGGG - Intergenic
1070286863 10:75089974-75089996 TTCAAACACAGGTAGATGGAGGG - Intergenic
1071944324 10:90624513-90624535 CTAAAACACATGTAGATTAAAGG + Intergenic
1071967364 10:90865785-90865807 CTCCAACACAAATAGCTTTTAGG + Intergenic
1072043756 10:91634263-91634285 CTCAACCAAAACTAGCTGGAAGG + Intergenic
1077249609 11:1555202-1555224 CCCAAACACAAGTGGCTTTTGGG - Exonic
1080790055 11:35514516-35514538 CCCAAACTCTAGGAGCTTGAAGG + Intronic
1082723540 11:56707806-56707828 ACCAAACACAAGAAGCTTAAAGG + Intergenic
1084867141 11:72068263-72068285 CTGAAACACAAGTGTGTTGAGGG - Intronic
1088128104 11:106452777-106452799 CTCATGCACAAGAAGCTTGGGGG + Intergenic
1089293851 11:117456390-117456412 AACAGACACAAGTAGTTTGATGG + Intronic
1091750793 12:3020280-3020302 CTGGAACAGAAGTTGCTTGAGGG + Intronic
1091975918 12:4825062-4825084 CTCAAACACAAGTAGCTTGAAGG - Intronic
1097009584 12:55942742-55942764 TTCAAACAGAAGGAGTTTGAGGG + Intronic
1097533886 12:60840406-60840428 CTCAATCACATGTTGCTTAAGGG - Intergenic
1099593619 12:84627920-84627942 CACACACACAAATAGTTTGAGGG + Intergenic
1100991726 12:100258649-100258671 CACCAACACAAGAAGCTAGAAGG + Intronic
1101745367 12:107537691-107537713 CCCAAAGAGAAGTAGTTTGAAGG - Intronic
1107691717 13:42960172-42960194 CTCAAACATATGTAGATCGAAGG + Intronic
1109945421 13:69425252-69425274 TTCAAATACAAAAAGCTTGAAGG + Intergenic
1110369463 13:74724149-74724171 TTAAAACACAAGCACCTTGAGGG - Intergenic
1113305853 13:109077769-109077791 CTTAAGCACAAGAAGCATGAAGG - Intronic
1113363420 13:109653006-109653028 CTCAAACCCAAGTAGCCTGGAGG + Intergenic
1115065302 14:29252753-29252775 CTCAAACAAAAATACATTGAGGG - Intergenic
1118374615 14:65165837-65165859 CTCAAAATCAAGTAGGTTTATGG + Intergenic
1120026266 14:79588139-79588161 CTCACCCATAAGTAGCTTGAAGG + Intronic
1124034681 15:26044322-26044344 CTCAAAAACATAAAGCTTGAGGG - Intergenic
1124879204 15:33625984-33626006 TTCATAGACAAGAAGCTTGAAGG + Intronic
1127883769 15:63181053-63181075 CTGAAACTCAAGTAGCTATATGG - Intergenic
1131203799 15:90424485-90424507 CTCTAACACATGAAGCCTGATGG - Intronic
1131616299 15:94020328-94020350 CTTAAACACAACTAGCCTGGAGG - Intergenic
1131748033 15:95471311-95471333 CTTAAACATATGTAGCTTTAAGG + Intergenic
1133907242 16:10033525-10033547 CCCAAACACATTTAGCTTGATGG - Intronic
1138387492 16:56645890-56645912 CTCTTTCCCAAGTAGCTTGATGG - Intronic
1140502206 16:75442990-75443012 ATCAAACAAAAGTTTCTTGATGG + Intronic
1150885446 17:69080584-69080606 CACAGACACAAGGAGGTTGATGG + Intronic
1151371746 17:73651173-73651195 CTAGAATACAAGCAGCTTGAAGG + Intergenic
1153490766 18:5645699-5645721 CTCCAAGAAAAGTATCTTGAAGG - Intergenic
1154412767 18:14150236-14150258 CTCAAACAGAAGTGTCTTGGAGG - Intergenic
1155506194 18:26535651-26535673 CCAAAACACAAGTATATTGATGG - Intronic
1157431640 18:47632927-47632949 CTCAATCACAATGACCTTGATGG + Intergenic
1159066874 18:63579383-63579405 CTCAAACCCGTGTTGCTTGAGGG - Intergenic
1159798853 18:72871977-72871999 CTCAAAAACAAGTAATTTGCTGG + Intergenic
1160104139 18:75953853-75953875 CTCTAACAAAAGAGGCTTGAGGG - Intergenic
1160156553 18:76438343-76438365 CCCAAACACAAGTAGGCTCAGGG - Intronic
1162204747 19:9047326-9047348 TTCATCCACCAGTAGCTTGAGGG - Intergenic
1162210968 19:9091766-9091788 TTCAAACACAGGTATCTGGAAGG + Intergenic
1165380977 19:35480155-35480177 CTCAAAAAAAAGTTGATTGAAGG - Intergenic
1166391242 19:42409977-42409999 CTCAAACTCAAGTGACTTCAGGG + Intronic
1167785853 19:51635733-51635755 GTCAAGTACAGGTAGCTTGAAGG + Intronic
1168368445 19:55810494-55810516 CTCAAAAACAAGCAACATGATGG - Intronic
926486564 2:13468087-13468109 CTCATGCACAATTACCTTGAAGG - Intergenic
926980636 2:18563605-18563627 TTCAAAGAGAAGTAGTTTGATGG + Exonic
929349080 2:40926274-40926296 CAGAAAGACAAGTAGCTTTAAGG + Intergenic
930862625 2:56090788-56090810 CTAAAACACACTTAGCTTGATGG - Intergenic
932576826 2:72966966-72966988 CTCAAACACAGGCTGATTGAGGG + Intronic
932739711 2:74282344-74282366 CCCAAAGAGGAGTAGCTTGAAGG - Intronic
933160986 2:79025066-79025088 CTCACACAAAGGTAGCTGGAAGG + Intergenic
935862015 2:107341553-107341575 CTAAAATGCAAATAGCTTGAAGG - Intergenic
936485640 2:112923227-112923249 CACTAACACAAGGAGCTTAAAGG - Intergenic
936979156 2:118248331-118248353 CTCACACACAACTAGCTAAATGG - Intergenic
936988125 2:118331283-118331305 CTCAAATTCAAGGAGCTAGAAGG - Intergenic
940942969 2:159583894-159583916 AGCAAATACAAATAGCTTGAGGG + Intronic
941747110 2:169098497-169098519 CTCCACCACATCTAGCTTGAAGG + Intergenic
942028800 2:171937727-171937749 CTGAAATAGAAGTAGCATGATGG + Intronic
945464005 2:210145802-210145824 CTCAAACACAAGAACCATCATGG - Intronic
945525012 2:210877749-210877771 CTCAGACACAAGTTACGTGAAGG + Intergenic
1171823490 20:29875669-29875691 CACAGACACAGATAGCTTGAAGG - Intergenic
1172395078 20:34597334-34597356 CTCAAAAACAAGCTGGTTGAAGG + Intronic
1176006133 20:62863632-62863654 CTCAAACTCAAGAAACATGAAGG + Intergenic
1176860239 21:14008019-14008041 CTCAAACAGAAGTGTCTTGGAGG + Intergenic
1180600445 22:17011984-17012006 CTCACACACACATAGCATGACGG - Intergenic
1184705427 22:46209306-46209328 CTCAAGCACAAGGAGCATAAAGG - Intronic
952088142 3:29851508-29851530 CTCAAAAACAGGTAGTTTGGTGG + Intronic
955533076 3:59894492-59894514 CTGAAACACAGATAGCCTGATGG - Intronic
955825434 3:62941294-62941316 CTCAGAAGCAAGTAGCTGGAGGG + Intergenic
956868740 3:73395748-73395770 CTCAAACATAAGGTCCTTGAGGG - Intronic
957561060 3:81821446-81821468 TTTAAACACAATTACCTTGAAGG + Intergenic
958712806 3:97738842-97738864 CTCAAACAAAAGTATATTAATGG - Intronic
961507775 3:127382582-127382604 CTTAAGCACAGCTAGCTTGAGGG + Intergenic
961779953 3:129315535-129315557 CTCAACCGCAAGAAGCTGGAGGG - Exonic
962731565 3:138288598-138288620 CTCAAACTCAAATGTCTTGAGGG - Intronic
966745490 3:183271508-183271530 CTCTAACACCAGTAGCTACATGG - Exonic
967539963 3:190656024-190656046 CTCAACCACAATGAGCTTGGTGG - Exonic
969881995 4:10182236-10182258 CTCACCCACAAGCAGCATGAGGG - Intergenic
976082888 4:81375695-81375717 CTTAAACAGAAGGAGGTTGAGGG + Intergenic
978048462 4:104164877-104164899 CTGAATGAAAAGTAGCTTGAAGG + Intergenic
984531053 4:180916718-180916740 CTCAAACATAACAAGCCTGAGGG - Intergenic
986282307 5:6333760-6333782 CTCAATCAGAAGCAGCTTAAAGG + Intergenic
988222456 5:28366354-28366376 CCCAAACAAAAATAGATTGATGG + Intergenic
988427067 5:31076126-31076148 CTCAACCACACGTAGATTCATGG - Intergenic
993585780 5:89725970-89725992 CTCAAACTCAAATGTCTTGAAGG + Intergenic
995609824 5:113897648-113897670 TTCAAACCCATGTTGCTTGAGGG - Intergenic
996156769 5:120112263-120112285 CTCAAAGACAGGTAGCTTCATGG + Intergenic
996697632 5:126416525-126416547 CTCAAAGACAAGAACCTTGTTGG - Intronic
997327063 5:133030400-133030422 CTCAAACAAAACTGGCTGGAAGG - Intergenic
998090662 5:139365870-139365892 CCTATACAGAAGTAGCTTGATGG + Intronic
1000595093 5:163206651-163206673 CTCAAAAACAAGGAGCTGGGGGG - Intergenic
1008122018 6:47629575-47629597 ATCAGACACAAGTATCTTTATGG + Intergenic
1015491093 6:133826434-133826456 CACAAACCCAAGAAGCTTGCTGG + Intergenic
1019404183 7:875103-875125 CTGAATTACAAGTTGCTTGATGG + Intronic
1024702199 7:51916220-51916242 TGAAAACAAAAGTAGCTTGAGGG + Intergenic
1026598816 7:71756011-71756033 CCCAAACACAAGAAACATGAAGG - Intergenic
1027938844 7:84645876-84645898 CTCATACTCAAGTATTTTGAGGG + Intergenic
1032542796 7:132717662-132717684 CTCCACCACAGGTGGCTTGAGGG + Intronic
1039928970 8:41965607-41965629 ATCAAACTAAAGTAGATTGAAGG - Intronic
1040081932 8:43293791-43293813 CTCAAAAACAAGTATTCTGAAGG + Intergenic
1041551934 8:59112721-59112743 CTCAAACAGAAGCTTCTTGAGGG + Intronic
1041987603 8:63944161-63944183 CTAAAACACAAGAAGCATAAAGG - Intergenic
1042019783 8:64359448-64359470 TTTAAACACAATCAGCTTGAGGG + Intergenic
1043005076 8:74808879-74808901 CTCAAGCATGAGTTGCTTGAAGG + Intronic
1043578203 8:81681954-81681976 CTGAAATAAAAGAAGCTTGAAGG + Intronic
1043657766 8:82692366-82692388 CTGAAACACATGTACCTTCAGGG - Intergenic
1044484193 8:92731040-92731062 CTCAAAAACAAGTTGCTGAATGG - Intergenic
1046576099 8:116030955-116030977 TTTAAACACAACTAGTTTGATGG + Intergenic
1048622118 8:136144962-136144984 ATCAAACACATGTGGCTTCATGG - Intergenic
1050035361 9:1429931-1429953 TTCAAACGCATGTTGCTTGATGG - Intergenic
1050286083 9:4103812-4103834 CATAAACACAAGTATATTGATGG + Intronic
1051585461 9:18722303-18722325 CTCAAAAAGAAGTATCTAGAAGG - Intronic
1052138517 9:24946790-24946812 CTAAAACACAAGTAGTGTAAAGG - Intergenic
1053513807 9:38711965-38711987 CTGAAATTCAAGTAGCCTGATGG - Intergenic
1053749239 9:41235978-41236000 CACAGACACAGATAGCTTGAAGG + Intergenic
1054949192 9:70831203-70831225 CTCAAACAAAAATAGATTGCTGG - Intronic
1057090339 9:92252390-92252412 CTCACACACACGTATCTAGAAGG - Intronic
1060697070 9:125718488-125718510 CTCAAACTCAAGTACCTGTAAGG - Intergenic
1186408383 X:9323965-9323987 CTCAAACTCAAATACCTAGAAGG + Intergenic
1188540459 X:31244411-31244433 CTTATACATAAGTAGCTTGTTGG + Intronic
1189731987 X:44030632-44030654 CTCAAACAGAAGAAGTTGGATGG + Intergenic
1189887982 X:45568712-45568734 CTGAAATAAAAGTAGCTTTATGG - Intergenic
1190246245 X:48692390-48692412 CTCACACACCAGGATCTTGATGG + Intergenic
1192544175 X:71999069-71999091 GTCAGACACAAGGAGGTTGAGGG - Intergenic
1193786382 X:85764466-85764488 ATCAAATACAAGTATCTGGAGGG - Intergenic
1196784475 X:119410046-119410068 CTCCAACCCAAGGAGCATGAGGG - Intronic
1197353771 X:125409002-125409024 TTCAAAGACAAATAGTTTGAAGG - Intergenic