ID: 1091976556

View in Genome Browser
Species Human (GRCh38)
Location 12:4830469-4830491
Sequence AGTGGGACTCACCACTGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091976556_1091976564 -3 Left 1091976556 12:4830469-4830491 CCCCTGCAGTGGTGAGTCCCACT 0: 1
1: 0
2: 0
3: 10
4: 148
Right 1091976564 12:4830489-4830511 ACTCCGGACACCTGGCCAATGGG 0: 1
1: 0
2: 0
3: 5
4: 65
1091976556_1091976563 -4 Left 1091976556 12:4830469-4830491 CCCCTGCAGTGGTGAGTCCCACT 0: 1
1: 0
2: 0
3: 10
4: 148
Right 1091976563 12:4830488-4830510 CACTCCGGACACCTGGCCAATGG 0: 1
1: 0
2: 0
3: 6
4: 79
1091976556_1091976567 9 Left 1091976556 12:4830469-4830491 CCCCTGCAGTGGTGAGTCCCACT 0: 1
1: 0
2: 0
3: 10
4: 148
Right 1091976567 12:4830501-4830523 TGGCCAATGGGAGCTTAACAAGG 0: 1
1: 0
2: 0
3: 6
4: 122
1091976556_1091976569 12 Left 1091976556 12:4830469-4830491 CCCCTGCAGTGGTGAGTCCCACT 0: 1
1: 0
2: 0
3: 10
4: 148
Right 1091976569 12:4830504-4830526 CCAATGGGAGCTTAACAAGGTGG 0: 1
1: 0
2: 1
3: 6
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091976556 Original CRISPR AGTGGGACTCACCACTGCAG GGG (reversed) Intronic
900127624 1:1075511-1075533 AGTGGGAACCAGGACTGCAGAGG + Intergenic
901150128 1:7095787-7095809 AGAGTGGCACACCACTGCAGGGG + Intronic
901825183 1:11856799-11856821 AGAGGAACTCAGCACTGCGGAGG + Intergenic
902343767 1:15801018-15801040 AGTGGGACTGACCAGTGTTGGGG + Intergenic
903357014 1:22754575-22754597 AGTGGAGCTTACCACTGCTGGGG + Intronic
904936739 1:34135893-34135915 AGTGGGACTGGGCTCTGCAGTGG + Intronic
906936697 1:50220337-50220359 AGTGGCTTTCACCACAGCAGGGG + Intergenic
910873278 1:91854234-91854256 AGTGGGGGTCACCTCTACAGGGG - Intronic
914029302 1:143942556-143942578 ATTTGGACTCTCCACTGCAAGGG + Intergenic
914160147 1:145125394-145125416 ATTTGGACTCTCCACTGCAAGGG - Intergenic
915714234 1:157929557-157929579 AATGGTCCTCACCACTGCAAAGG + Intergenic
919088190 1:192946664-192946686 AGTGAGACTCTGCAGTGCAGTGG + Intergenic
920244060 1:204574897-204574919 ATCTGGACTCACCACTGCTGTGG + Intergenic
920464771 1:206173441-206173463 ATTTGGACTCTCCACTGCAAGGG + Intergenic
1064915999 10:20459220-20459242 TGTAGGAGTCACCACTGCTGTGG + Intergenic
1065277526 10:24099893-24099915 GGTGGGAATCATCTCTGCAGTGG - Intronic
1065326451 10:24554150-24554172 AGTGGGGGACACCCCTGCAGGGG + Intergenic
1067250399 10:44581672-44581694 GGTGAGGCTCAGCACTGCAGGGG + Intergenic
1073281600 10:102358563-102358585 AGAGGGACTGACCACTGCTGAGG - Exonic
1074698008 10:116068176-116068198 AGAGGCACTCAGCACTCCAGAGG + Intronic
1075273420 10:121072973-121072995 ATAGGGACTCACCACTACACCGG + Intergenic
1076510449 10:131010459-131010481 GGTTGGACACACCACTTCAGGGG - Intergenic
1076700095 10:132267034-132267056 TTTGGGTCTCCCCACTGCAGCGG - Intronic
1077817931 11:5706231-5706253 ATTCAGACTGACCACTGCAGAGG - Intronic
1078977723 11:16496771-16496793 AGGGGCACACACCACTGCTGAGG + Intronic
1079423213 11:20314506-20314528 AGTGGGCCTGATCACTTCAGGGG + Intergenic
1081698212 11:45133623-45133645 AGTGGAGCTCAGCACAGCAGTGG + Intronic
1083333355 11:61909291-61909313 AGTGGGACTCAGGACGGCTGAGG + Intronic
1084772562 11:71353164-71353186 AGTGGGGGTCACCACTGGGGAGG + Intergenic
1085478999 11:76806316-76806338 GGTGGGACTCACCTCTCCACAGG - Intergenic
1085637895 11:78172251-78172273 GGTGGGACACAGGACTGCAGGGG + Exonic
1086918367 11:92557322-92557344 AGTGGGAGTCACAGGTGCAGGGG - Intronic
1091976556 12:4830469-4830491 AGTGGGACTCACCACTGCAGGGG - Intronic
1094781382 12:33795793-33795815 GGTGGGCATAACCACTGCAGTGG - Intergenic
1098025507 12:66196608-66196630 AGTAGGACTCATAACTGCGGAGG - Intronic
1098172279 12:67759093-67759115 AGGAGAAATCACCACTGCAGGGG + Intergenic
1099021337 12:77408211-77408233 ACATGGGCTCACCACTGCAGAGG - Intergenic
1101759448 12:107646786-107646808 AGTGAGAAACAACACTGCAGTGG + Intronic
1106561113 13:30847071-30847093 AGTGGGATGCACCTCAGCAGAGG - Intergenic
1109845254 13:67980826-67980848 AGTGGAGCACACCACTGCTGGGG + Intergenic
1114222534 14:20709630-20709652 AGTGAGTATCACCCCTGCAGGGG - Intergenic
1116183399 14:41565122-41565144 TGTGGGACTCTACACTGAAGAGG + Intergenic
1121278699 14:92685276-92685298 AGTGAGACTCCCCACACCAGAGG + Intronic
1126172269 15:45704824-45704846 ACTGGGTCTCCCCACTGCACTGG + Intergenic
1126759061 15:51952657-51952679 TGGGGGACACACCTCTGCAGTGG + Intronic
1133001914 16:2856133-2856155 AATGGGACCCACCACTGCGCAGG - Exonic
1133246924 16:4455209-4455231 AGCCGGACCCACCACTGCAGGGG - Intronic
1133354652 16:5127010-5127032 AGTAGGAACCAGCACTGCAGAGG + Intergenic
1138387448 16:56645480-56645502 AGTGGCTCACACCACTTCAGTGG + Intronic
1140745548 16:77977261-77977283 AGTGGGACTCAGTCCTGCTGGGG - Intronic
1146964812 17:37017063-37017085 ATTGGAGCTCCCCACTGCAGTGG - Intronic
1147926302 17:43948034-43948056 AGTGGGACTGAGCACTTTAGGGG + Intergenic
1148474011 17:47915333-47915355 ACTGGGACTCACAGCAGCAGTGG - Exonic
1150696965 17:67413880-67413902 ATTGGGAATCCCCACTCCAGAGG + Intronic
1151047073 17:70933231-70933253 AGTGGGCCTCTCCACTTCGGTGG - Intergenic
1151969754 17:77451518-77451540 AGCAGGACTCACCCCAGCAGCGG - Intronic
1152594862 17:81233157-81233179 AGTGGGACTCACCCCTGCCACGG + Intronic
1159831410 18:73282448-73282470 AGTGGCACTCCACAGTGCAGTGG - Intergenic
1160246032 18:77160343-77160365 AGTGCAACTCAGCATTGCAGTGG + Intergenic
1161115661 19:2495265-2495287 GGTGGGACTCTACACTGCAGAGG - Intergenic
1161739677 19:6013045-6013067 AGCCGGACTCACCACTGAACCGG - Exonic
1164494095 19:28742515-28742537 AGTGGAAGCCATCACTGCAGAGG + Intergenic
1165294127 19:34912487-34912509 AGTGGGAATAGCCACTGCAAAGG + Intergenic
1167121720 19:47521216-47521238 CACGGGAGTCACCACTGCAGGGG + Exonic
927173803 2:20391629-20391651 ATTGGGCCTCACCCATGCAGAGG + Intergenic
936022366 2:109004573-109004595 AGTGGGTTCCACCACTGCAAAGG + Intergenic
936155042 2:110041847-110041869 ACTGGGAATCACCAGTGCTGAGG - Intergenic
936189640 2:110329567-110329589 ACTGGGAATCACCAGTGCTGAGG + Intergenic
939842192 2:147202771-147202793 TCTTGGACTCAGCACTGCAGAGG + Intergenic
940975464 2:159938455-159938477 ATGGGATCTCACCACTGCAGGGG + Exonic
946284767 2:218694625-218694647 GGGGGGCCTCACCTCTGCAGGGG - Exonic
948627029 2:239275702-239275724 AGTGGGACCAGGCACTGCAGAGG - Intronic
948764266 2:240211542-240211564 TGTGGGTCTCGCCTCTGCAGTGG + Intergenic
948764267 2:240211553-240211575 AGTGGGGAAGACCACTGCAGAGG - Intergenic
948808232 2:240462051-240462073 AGTCGGACGCCACACTGCAGCGG - Intronic
948871148 2:240798892-240798914 TGTGGGACTCACCACTGAGTGGG - Intronic
1172941186 20:38655885-38655907 ACTGGGACTCCACGCTGCAGGGG + Intergenic
1173307449 20:41863704-41863726 AGTGGGGCTCATCCCTGCTGGGG + Intergenic
1173978150 20:47202847-47202869 TGTGGGACAGACAACTGCAGTGG - Intergenic
1174435871 20:50506391-50506413 AGTGGCCCTCACGCCTGCAGGGG - Intergenic
1175874038 20:62221016-62221038 AGGGGCAGTCGCCACTGCAGCGG + Intergenic
1178682528 21:34685018-34685040 AGGGAGACTCTCCACTGGAGAGG + Intronic
1180597544 22:16988473-16988495 GGCAGCACTCACCACTGCAGAGG - Intronic
1182500932 22:30746976-30746998 AGTGGGACTTACCCCAGGAGTGG + Intronic
1182575195 22:31268190-31268212 GGTGGGACTCACCATTCCGGAGG - Exonic
1183617630 22:38955006-38955028 AGAGGGACAGACCAGTGCAGAGG - Intronic
1183714989 22:39528333-39528355 AATGGGAGTCACCACAGCAAAGG + Intergenic
1184769316 22:46588478-46588500 AGTGGGTCAAACCACTACAGAGG + Intronic
1185269308 22:49921614-49921636 AGCGGGAATGGCCACTGCAGCGG + Exonic
950619907 3:14196575-14196597 AGTGGGATTCACCACTGTTAGGG - Intronic
950620324 3:14200375-14200397 AGTGGACAGCACCACTGCAGAGG - Exonic
955175100 3:56606095-56606117 AGGGGCACCCACCACTGCTGAGG - Intronic
956385840 3:68718412-68718434 AGGGGCACTCATTACTGCAGGGG + Intergenic
959995710 3:112678194-112678216 ACTGGGACCAAGCACTGCAGAGG + Intergenic
964865560 3:161255934-161255956 TGTTGGAGTCAGCACTGCAGTGG + Intergenic
970337553 4:15065735-15065757 AGTGTGACTCGCACCTGCAGTGG + Intronic
971193247 4:24447526-24447548 AGTGGGACTGGGCTCTGCAGAGG - Intergenic
971838666 4:31803027-31803049 TGTGAGACTCTCCAGTGCAGTGG + Intergenic
972172200 4:36360091-36360113 AGTTTGACCCAACACTGCAGAGG + Intergenic
972702764 4:41509836-41509858 AGAGGGACTCAGCACAGTAGGGG + Intronic
974014290 4:56634797-56634819 AGTGGGACTAAGAACTCCAGGGG - Intergenic
974699650 4:65424052-65424074 GGTGGGACTCACCATTAGAGTGG - Intronic
978814355 4:112885992-112886014 AGTGAGACTGAGCTCTGCAGAGG - Intronic
983186222 4:164704229-164704251 AGAGGTACACACCTCTGCAGAGG + Intergenic
986242413 5:5972914-5972936 AGGAGGACTCACCAAAGCAGGGG + Intergenic
989130550 5:38102877-38102899 AGAGGGGATCACTACTGCAGAGG - Intergenic
991254735 5:64601583-64601605 AGTGGAACTCAGCAGTGCAAGGG - Intronic
992012140 5:72539586-72539608 ATTGGGGCTAACCACTGCAGGGG + Intergenic
997710262 5:135998278-135998300 AGTGGCACTCATCATGGCAGTGG - Intergenic
998806155 5:145919490-145919512 AGTGGGACTCAGCATTGCACTGG - Intergenic
999092834 5:148952527-148952549 TGAGTGTCTCACCACTGCAGGGG + Intronic
999264527 5:150257646-150257668 AGTGGGACACACTGCTGCACAGG + Intronic
1003476784 6:6491084-6491106 ATTGGTACCCATCACTGCAGGGG + Intergenic
1006001933 6:30972098-30972120 AGTGAGAATCAACACAGCAGAGG - Intergenic
1006868967 6:37233023-37233045 ATTGGGAGTCACCAGTGTAGTGG - Intronic
1008253531 6:49269448-49269470 AGTAGGAATAACCACTGCAATGG + Intergenic
1011308781 6:85958594-85958616 AGTGAAACACACCACTGCTGAGG - Intergenic
1017241465 6:152174318-152174340 AGTGGGACTGAACACAGCACTGG + Intronic
1018038190 6:159899316-159899338 AGTGTAACTGACCACTCCAGGGG + Intergenic
1019547008 7:1582991-1583013 AGTGCCACTGACCTCTGCAGTGG - Intergenic
1021664520 7:22962626-22962648 AGTGGGGGTCATCACTGAAGGGG + Intronic
1023793431 7:43771652-43771674 AGTGGGCGTCAGCACAGCAGTGG - Intronic
1023857027 7:44190152-44190174 ACTGGGACTCCCCACTGCACAGG - Intronic
1024852700 7:53739664-53739686 AGTGGGGCTCAAGACTTCAGTGG + Intergenic
1026988949 7:74572179-74572201 TGTAGGACTGACCTCTGCAGAGG + Intronic
1029977245 7:104846453-104846475 GTTGGGTCTCAACACTGCAGGGG - Intronic
1032401617 7:131628243-131628265 CTTGGGACCCAGCACTGCAGAGG + Intergenic
1032865944 7:135924489-135924511 AGATGGATTCCCCACTGCAGTGG - Intergenic
1033596985 7:142865620-142865642 TGAGGAACTCACCAGTGCAGGGG - Exonic
1033597125 7:142866132-142866154 AGTGGACCTCATCCCTGCAGCGG - Exonic
1034714476 7:153228519-153228541 AGGGGGACTAACCACTGAAACGG + Intergenic
1036586127 8:10125447-10125469 AGTGAGAATCACCTGTGCAGTGG + Intronic
1037930977 8:22880231-22880253 AGTGGGCCCCACCTCTTCAGTGG + Intronic
1038443353 8:27586630-27586652 AGAGGGACTCTCCTCTGAAGAGG + Intergenic
1040389932 8:46941151-46941173 AGTGGCACTCACCATTGCTGAGG + Intergenic
1043866261 8:85379045-85379067 ACTGGGACTCACCACTGCTCTGG - Intronic
1045768287 8:105703396-105703418 AGTGGGACTCACCACTTGGAAGG + Intronic
1051585663 9:18724220-18724242 AGTGGGACTAACAACTGCCTGGG - Intronic
1051675709 9:19556310-19556332 AGTTGGATTCACCAGTTCAGAGG + Intronic
1051858679 9:21599700-21599722 AGTTGCACTGACCACTGGAGTGG - Intergenic
1052215335 9:25960261-25960283 AGTTGGAGTTACCACTACAGAGG - Intergenic
1052696816 9:31888838-31888860 AGGGGCACCCACCATTGCAGAGG - Intergenic
1054766506 9:69046912-69046934 ACTGAGACTCAACAATGCAGAGG - Intronic
1055537870 9:77267990-77268012 AGCGGGAATCACCACTGCTGAGG - Intronic
1057828355 9:98388410-98388432 GCTGGGAATCACCACTGAAGGGG - Intronic
1060243084 9:121921579-121921601 AGGGGGACTCAGCACTGGGGAGG - Intronic
1062305642 9:135905567-135905589 AGTGAGACACTCCACAGCAGCGG + Intronic
1186304701 X:8243258-8243280 AGTGGGACTCCCCAATGACGTGG + Intergenic
1191869195 X:65731200-65731222 AGTGGGGCCCACCACTGCTTGGG - Intronic
1193017259 X:76749654-76749676 AGTGTGCTTAACCACTGCAGGGG - Intergenic
1198168382 X:134079900-134079922 AGGGGCACTCACCATTGCTGAGG + Intergenic
1198704701 X:139436135-139436157 AGGGGCACTCACCATTGCCGAGG + Intergenic
1199602065 X:149547071-149547093 GGTGGGACTCTCCAAAGCAGTGG - Exonic
1199648322 X:149932413-149932435 GGTGGGACTCTCCAAAGCAGTGG + Exonic
1200091125 X:153636537-153636559 GGCTGGGCTCACCACTGCAGCGG + Intergenic
1200768548 Y:7102485-7102507 ACTGAGACTCTCCACTGTAGTGG - Intergenic
1202060194 Y:20878877-20878899 AGTGGGACTCCCTATGGCAGAGG + Intergenic
1202329082 Y:23726661-23726683 AGGTGGCCTCACCACAGCAGAGG + Intergenic
1202541689 Y:25943393-25943415 AGGTGGCCTCACCACAGCAGAGG - Intergenic