ID: 1091978955

View in Genome Browser
Species Human (GRCh38)
Location 12:4850282-4850304
Sequence CAGGCTGAGGGTCCGAGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 304}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091978949_1091978955 -10 Left 1091978949 12:4850269-4850291 CCTGACGCTGGTGCAGGCTGAGG 0: 1
1: 0
2: 3
3: 26
4: 243
Right 1091978955 12:4850282-4850304 CAGGCTGAGGGTCCGAGAGGGGG 0: 1
1: 0
2: 4
3: 40
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091978955 Original CRISPR CAGGCTGAGGGTCCGAGAGG GGG Intronic
900296960 1:1956710-1956732 CAGCGTGATGGTCCGAGACGTGG + Exonic
900317016 1:2061961-2061983 CAGGCTGAGGGTCAGTGAGAAGG + Intronic
900398288 1:2462239-2462261 CAGGCAGAGGGTATCAGAGGAGG - Intronic
900408035 1:2500947-2500969 CAGCCTGAGGGTCCGAGATGGGG - Intronic
900614048 1:3556427-3556449 CTGGCTGTGGCTCCGTGAGGAGG - Intronic
900678691 1:3904209-3904231 CAGGATGAGGGAGGGAGAGGGGG - Intergenic
900704575 1:4072249-4072271 GAGACTGAGGCTCAGAGAGGAGG + Intergenic
900940405 1:5795039-5795061 CAGGGTGAGGGAGGGAGAGGAGG + Intergenic
902553921 1:17235596-17235618 CAGGCTCAGGGGCGGAGAGCCGG + Intronic
903176281 1:21583398-21583420 CAGGCTGTGAGTCCGAGAGATGG + Intergenic
903335970 1:22624892-22624914 CAGGCTGGGGGTTCGAGACATGG + Intergenic
904014355 1:27408630-27408652 CAGGCTGAGGGTCTGCTAGATGG - Intronic
904347693 1:29884047-29884069 CAGGATGATGAACCGAGAGGTGG + Intergenic
904467931 1:30719020-30719042 GAGGCTGAGGCCCGGAGAGGCGG + Intronic
905905475 1:41615378-41615400 CAGGCTGAGGGTTCTCCAGGTGG - Intronic
906677239 1:47701964-47701986 GAGGCTGGGGGTCAGGGAGGAGG - Intergenic
907735789 1:57110640-57110662 TAGGCTGAGGGTTTGAGAGCAGG - Intronic
907805441 1:57814603-57814625 CATACTGAGGGCCCAAGAGGAGG + Intronic
915493912 1:156267582-156267604 CAGGCTGAGGTTGGGTGAGGAGG + Exonic
915938203 1:160101133-160101155 CAGACTGCGGGTTCCAGAGGCGG + Intergenic
917004479 1:170397775-170397797 CAGACTGAGGGACAGAGAAGAGG - Intergenic
917702763 1:177597681-177597703 CAGGCAGAGAGTCTGATAGGAGG + Intergenic
918070297 1:181129344-181129366 CAGGCTGAGGGTCAAAGGGAGGG + Intergenic
918222803 1:182451270-182451292 CAGACTGAGCGTGTGAGAGGAGG - Intronic
918418012 1:184332314-184332336 CAGTCTGACTGTCAGAGAGGTGG - Intergenic
919766218 1:201129011-201129033 GAGGCTGAGGCTCAGAGAGGAGG + Intergenic
919814509 1:201429051-201429073 AAGGCTCAGGGTCCCAAAGGCGG + Intronic
920053371 1:203176323-203176345 GAGGCTGAGGGCCCTAGAGAGGG + Intergenic
920366858 1:205452517-205452539 CAGGCAGTGGGTCTGAGAAGTGG - Intronic
920690162 1:208140194-208140216 CAGGCTGATGGTCTCAGAGATGG + Intronic
924057650 1:240139719-240139741 CAGGCTGAGGTTTGGAGACGAGG + Intronic
1065712705 10:28533051-28533073 AAGGCCGAGGGTGGGAGAGGAGG + Intronic
1066088446 10:31994135-31994157 GAGGCTGAGGGTCTAGGAGGTGG + Intergenic
1069158028 10:65053833-65053855 GCGGCTGAGGGGCTGAGAGGCGG - Intergenic
1069753761 10:70761146-70761168 CAGGCCCAGGGTCTGTGAGGAGG - Exonic
1069982427 10:72261458-72261480 CAGGGGGAGGATCCCAGAGGGGG + Intergenic
1070309314 10:75261858-75261880 CAGACTGAGGCCCAGAGAGGAGG - Intergenic
1070328558 10:75402934-75402956 CAGACCGAGGCTCCCAGAGGTGG - Intergenic
1070567568 10:77615329-77615351 AAGGCTGAGGGTCTGAAAAGAGG - Intronic
1070669481 10:78368018-78368040 CAGGCTGAGGGCCCTGGATGTGG + Intergenic
1072797568 10:98367647-98367669 CAGACTGAGGCTCAGAGAGGAGG - Intergenic
1073065930 10:100759209-100759231 CAGGCTGATGGGCCCTGAGGAGG + Intronic
1073426448 10:103458226-103458248 CTGGCTGTTGGCCCGAGAGGTGG - Exonic
1075419005 10:122287058-122287080 CAGGCTCAGGCTCAGGGAGGGGG - Intronic
1075576325 10:123580379-123580401 CAGGGAGAGGGTCAGGGAGGTGG - Intergenic
1075671223 10:124265282-124265304 GAGCCTGAGGGCCCGAGAGGGGG - Intergenic
1075709248 10:124521911-124521933 GAGTCTGAGAGGCCGAGAGGTGG + Intronic
1075845771 10:125544173-125544195 CACGCTGAGGGTCGGTGACGAGG + Intergenic
1076477908 10:130765465-130765487 CAGGCTGAGGGTCAAGGAAGAGG - Intergenic
1077431717 11:2518938-2518960 CAGGCTGTGGGTCTGTGAAGCGG + Intronic
1079014559 11:16857496-16857518 CAGGAAGAGGCTCCAAGAGGCGG + Intronic
1080298701 11:30759547-30759569 CAGGCTGAGGGTCTAAGAAGGGG + Intergenic
1080725311 11:34893590-34893612 TAGGCTGATGGTAAGAGAGGAGG + Intronic
1083195245 11:61082136-61082158 CTGGCTGAGGGTGAGAGCGGAGG + Intergenic
1083304684 11:61756213-61756235 CTGGCTGAGGCTCAGAGAGAAGG + Intronic
1083638503 11:64133014-64133036 CAGGCTGAGGGTCAGTGAGCTGG + Intronic
1083844025 11:65320820-65320842 CTGGCTGAGGGTTGGAGAGGAGG + Exonic
1084146297 11:67266930-67266952 CGGGCTGGGGGGCCGACAGGGGG - Intronic
1084238926 11:67805690-67805712 CAGGATAAGGGTCCTGGAGGCGG + Intergenic
1084715563 11:70871294-70871316 GAGTCTGAGGGTCCAAGAGGAGG + Intronic
1085403065 11:76246018-76246040 CTGGCTGAGGGGGTGAGAGGGGG + Intergenic
1085702242 11:78755647-78755669 CAGGCTGAGGAGCAGAGAGCAGG - Intronic
1089191276 11:116655050-116655072 TAGGCTGGTGGTCCCAGAGGAGG + Intergenic
1090621478 11:128564589-128564611 CAGGCTGAAGGACGGGGAGGGGG + Intronic
1091978955 12:4850282-4850304 CAGGCTGAGGGTCCGAGAGGGGG + Intronic
1094564965 12:31590965-31590987 CAGGCTGCGGCGGCGAGAGGCGG - Exonic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1096836682 12:54355690-54355712 CAGGCTGGGGGTCAGAGCTGGGG - Intergenic
1101612558 12:106304201-106304223 GAGGTTGAGGGCCCCAGAGGGGG + Intronic
1102164458 12:110795336-110795358 CAGGCTCAGAGTCAGAGATGGGG + Intergenic
1103419225 12:120766740-120766762 CAAGCTGAGGCTCAGAGAGGTGG - Intronic
1104492595 12:129208039-129208061 CAGCCTGAGGGGCCGAGCAGAGG + Intronic
1104691488 12:130829613-130829635 CAGGCTGTGGGCCCGAGAGGCGG - Intronic
1105295487 13:19085412-19085434 CAGGCTGGGGGATCCAGAGGTGG + Intergenic
1105690914 13:22838370-22838392 CCCGCTGAGGCCCCGAGAGGGGG + Intergenic
1106479560 13:30126890-30126912 CAGCCAGAGGGTGCGACAGGAGG + Intergenic
1106619205 13:31357278-31357300 CAGCCTGACGGCCTGAGAGGAGG + Intergenic
1106691135 13:32117944-32117966 GAGGCTGAGGTACAGAGAGGCGG - Intronic
1106925277 13:34606878-34606900 GAGGATGAGGGTCGGGGAGGGGG + Intergenic
1107456364 13:40559508-40559530 CAGGCTGAGGGTTAGTGAGCAGG - Exonic
1108945393 13:56016975-56016997 CAGGGTGAGGCTGAGAGAGGAGG - Intergenic
1109021490 13:57100075-57100097 CAGGCTGTCGGACAGAGAGGAGG - Intergenic
1113871902 13:113564873-113564895 GGGGCTGAGGGCCCGAGGGGAGG - Intergenic
1113872075 13:113565612-113565634 CGGTCTGAGGGTCTGGGAGGAGG - Intergenic
1113872142 13:113565870-113565892 CGGTCTGAGGGTCTGAGGGGAGG - Intergenic
1115346130 14:32344985-32345007 TAGGATGAGGCTCAGAGAGGAGG + Intronic
1115537234 14:34384669-34384691 CAGGCTGAGGGTGTGGTAGGAGG + Intronic
1118319618 14:64745545-64745567 CAGTGTGAGGGTCAGGGAGGCGG - Exonic
1118320340 14:64748988-64749010 CAGGAGGAGGGTGGGAGAGGAGG + Exonic
1119656876 14:76423578-76423600 CAGGATCAAGGTCCGAGAAGAGG - Intronic
1121448420 14:93992863-93992885 CAGGCTGAGGGCCTCAGAGGAGG + Intergenic
1121539006 14:94711225-94711247 CAGGCGGAGGGGTGGAGAGGGGG - Intergenic
1121680973 14:95792490-95792512 GAGGCTGAGGGCCTGGGAGGGGG + Intergenic
1122139155 14:99652127-99652149 CAGACTGAGGCTCTGAGAGATGG + Intronic
1122416072 14:101550098-101550120 CTGACTGAGGGTCCGGGAGGAGG - Intergenic
1123700069 15:22907728-22907750 CAGGCCGAGGGTCAGAGTTGGGG + Intronic
1124599317 15:31118602-31118624 CAGGCTGAAGGTCCAAGATCAGG + Intronic
1128074302 15:64816676-64816698 CAGGCTGCGGGCCCGAGAAAGGG + Exonic
1129114578 15:73358117-73358139 GAAGCTGAGGGTGGGAGAGGTGG + Intronic
1129144206 15:73632983-73633005 GGGGCTGCGGGTCCGAGAGGAGG - Intronic
1129229196 15:74187306-74187328 CAGGCACAGGATCCCAGAGGTGG - Intronic
1129262050 15:74374086-74374108 GAGGCTGAGGGCCTGAGGGGAGG + Intergenic
1129427757 15:75476804-75476826 GAGGCTGAGGGTCAGAGATGTGG - Intronic
1129656834 15:77530027-77530049 CAGGGTGAGGGTAGGAGAGGTGG + Intergenic
1130305558 15:82710237-82710259 CAGGCTGGGGGTTCTAGAGCGGG + Intergenic
1131117697 15:89804788-89804810 GAGGCTGTGGGTCCTAGAGAAGG + Intronic
1132585833 16:705471-705493 CGGGCTGCGGGGCCGGGAGGGGG - Intronic
1132793471 16:1706686-1706708 CTGGCTGGGGGTCCGGGACGGGG - Intronic
1132990579 16:2790767-2790789 GAGGCTGAGGGACACAGAGGAGG + Intergenic
1136239781 16:28936951-28936973 AAGGCTAAGGGTCCGCGCGGCGG - Intronic
1136381583 16:29898503-29898525 CTGGCTGGGGGTCAGAGTGGGGG + Intronic
1136537531 16:30909072-30909094 CAGTGTGAGGCTCGGAGAGGAGG + Intergenic
1136637083 16:31531234-31531256 CAGGTTGAGGGTCAGAGACAGGG - Intergenic
1137018284 16:35397189-35397211 CAGGATGAGGGGCAGGGAGGAGG - Intergenic
1138418825 16:56886429-56886451 CAGGCTGAGGTTCCGGGTGAAGG - Exonic
1140935140 16:79663354-79663376 CACGCTGAGGCTCAGAAAGGGGG + Intergenic
1141170051 16:81685265-81685287 CAGGCTGGGAGACCGAGAGGAGG + Intronic
1141386005 16:83623173-83623195 CCGGTTGAGGGGCTGAGAGGTGG + Intronic
1141611523 16:85183762-85183784 CAGGCTGAGGCTCAGAGAGGTGG + Intronic
1141658331 16:85428210-85428232 CAGGCTGAGGGCCCGAGACAAGG + Intergenic
1141783478 16:86181587-86181609 CAGGCTGAGGGTTGGGGAGCTGG - Intergenic
1142213622 16:88820580-88820602 CAGGCAGAGCTTCCCAGAGGGGG - Intronic
1142273718 16:89104710-89104732 GAGACTGAAGGTCAGAGAGGTGG - Intronic
1142433698 16:90044077-90044099 CAGACTGAGGGTCTGGGATGGGG + Exonic
1142594439 17:1022691-1022713 CAGGGTGAGGGCTGGAGAGGCGG - Intronic
1143148047 17:4789355-4789377 CAGGCTGAGGGTCCGGCAAAGGG + Intronic
1143611343 17:8019618-8019640 GAGGCTGAGGCACAGAGAGGAGG - Intronic
1143759527 17:9090918-9090940 CAGGCTGAGGGTCCCGGTGGAGG - Intronic
1145035529 17:19537837-19537859 CAGGCTGAGGCACTGAAAGGAGG - Intronic
1146176171 17:30667785-30667807 CAGGCGGAGGTTCCCAGAGTGGG - Intergenic
1146349629 17:32083896-32083918 CAGGCGGAGGTTCCCAGAGTGGG - Intergenic
1146912959 17:36659845-36659867 GGGTCTGAGGGTCCCAGAGGAGG + Intergenic
1147176153 17:38657454-38657476 CTGGCTGGGGCTCCGGGAGGTGG - Intergenic
1147632261 17:41939725-41939747 CAGGGAGAGGGGCCAAGAGGAGG + Intronic
1148022071 17:44559863-44559885 CAGGCCCAGCGTCAGAGAGGAGG - Intergenic
1148745457 17:49915678-49915700 AAGGCTGAGGGTCCTTGAGAGGG + Intergenic
1151188504 17:72381025-72381047 CAGGCTGGGGGTCAGAGGAGAGG + Intergenic
1151585803 17:75007768-75007790 CAGGCTGCTGGTGCGAGAAGGGG - Intergenic
1151947479 17:77327485-77327507 GAGCCTGAGGGTCCCTGAGGGGG + Intronic
1151966959 17:77436556-77436578 CAGGCTGAGGGTCTGCGTGGAGG - Intronic
1151978355 17:77494960-77494982 CAGGCAGAGGGGCCAAGGGGAGG - Intronic
1152042038 17:77909845-77909867 CAGGCTGCGGGTGCGGCAGGTGG - Intergenic
1152202676 17:78956267-78956289 CAGGGTGGGGGTCAGAGCGGGGG + Intergenic
1152302415 17:79503001-79503023 CAGGCTGGGAGTCCGAGATCAGG + Intronic
1152681832 17:81672476-81672498 CAGGCTGAGGGAGAGAGGGGAGG - Exonic
1152772913 17:82181121-82181143 GAGGCAGAGGGGCAGAGAGGAGG + Intronic
1152794709 17:82301346-82301368 CAGGCTGATGGGCCGAGGTGGGG + Intergenic
1153041010 18:812589-812611 CAGGCCGAGGGGGCGTGAGGAGG + Intergenic
1153879173 18:9405357-9405379 CAGCCTGAGGGTGAGAGAGACGG - Intergenic
1156256972 18:35408210-35408232 CAGGCTTAGGGTCTGAAAGGTGG - Intergenic
1160447132 18:78936661-78936683 AAGGCTGAGGGCCAGGGAGGTGG + Intergenic
1160447151 18:78936707-78936729 AAGGCTGAGGGCCAGGGAGGTGG + Intergenic
1160762822 19:794178-794200 GGGGCTGAGGGGCTGAGAGGTGG + Intergenic
1160807907 19:1000688-1000710 CAGGCCGCGGGTCAGCGAGGCGG - Exonic
1160982654 19:1823425-1823447 CAGGCTGAGGGCCCCAGGGAGGG + Intronic
1161010034 19:1955512-1955534 CAGGGTGAGGCTCCGCGGGGTGG + Intronic
1161828544 19:6586176-6586198 CAGGCTGATGCTACGGGAGGCGG + Exonic
1162304281 19:9862256-9862278 CAGGCTGAGGGTCTCTGAGGAGG + Intronic
1163369465 19:16893849-16893871 AAGGCAGAGGGTGCGAGAGCTGG + Intronic
1163529628 19:17842023-17842045 CAGAGTGAGGCTCCGAGAGCTGG - Intronic
1164648218 19:29874094-29874116 CTGGCTGCGGGTCCTGGAGGGGG + Intergenic
1165077293 19:33286916-33286938 CAGGCTGAAGGGGCGAGGGGAGG + Intergenic
1165095974 19:33410170-33410192 CAGGTTGAGGGTGCAAGCGGAGG - Intronic
1165279345 19:34783262-34783284 AAGGATCAGGGTCAGAGAGGAGG + Intergenic
1165315796 19:35054703-35054725 GAAGCTGAGGCTCAGAGAGGTGG - Intronic
1165845112 19:38813019-38813041 CAGCCTGAGAGTCCCAGAAGAGG - Exonic
1166074062 19:40403713-40403735 CAGGCTGAGGCTCCTGGCGGCGG + Exonic
1166267780 19:41695768-41695790 CAGGCTCAGGATCTGAGGGGTGG - Intronic
1167533746 19:50035764-50035786 CAGGCTGAGCATTAGAGAGGTGG + Intronic
925230273 2:2226758-2226780 CAGGCAGATGGTGGGAGAGGAGG - Intronic
925903880 2:8527652-8527674 GAGTCCGAGGGTCAGAGAGGCGG + Intergenic
926685595 2:15695449-15695471 CAGGCAGAGGGACTGACAGGTGG - Intronic
927639542 2:24838068-24838090 CAGGGAGAGGCTCAGAGAGGAGG - Intronic
927956114 2:27208390-27208412 CAGGTAGAGGGGCTGAGAGGTGG - Intronic
928087571 2:28355528-28355550 CAGCCTGGGAGTCCGAGAAGGGG - Intergenic
928217597 2:29375238-29375260 CATGCTGAGGGTCAGTGAGAAGG - Intronic
930019762 2:46994419-46994441 CAGGCAGAGGGTGGGACAGGGGG - Exonic
932086977 2:68771298-68771320 CAGGCGGAGGGTTGGAGAGGGGG - Intronic
932438921 2:71719567-71719589 CAAGCTGCGGGTCTGACAGGAGG - Intergenic
932597317 2:73102056-73102078 CAGGATGAGGGTGCGGGATGTGG + Intronic
933967730 2:87443569-87443591 CTGACTGAGGGCCTGAGAGGAGG - Intergenic
934564288 2:95329945-95329967 CCGGCAGAGGGGACGAGAGGGGG - Intronic
936326069 2:111506927-111506949 CTGACTGAGGGCCTGAGAGGAGG + Intergenic
937127420 2:119483307-119483329 GAAGCTGAGGTTCCAAGAGGGGG + Intronic
937216948 2:120318853-120318875 CAGACAGAGGGGCCGAGAAGGGG - Intergenic
940453719 2:153871826-153871848 CAGGCTGGGGCTACGAGAGGAGG + Intergenic
946336508 2:219040861-219040883 GAGGCTGAGGCTCCGGGAGATGG - Intronic
947642306 2:231713925-231713947 CAGGATGAGCGTCCAAGTGGTGG + Intergenic
947858628 2:233342295-233342317 CAGGCTGAGGGTGCATGAGGCGG - Exonic
948777867 2:240299239-240299261 CAGGCTGAGGAGCCCGGAGGAGG - Intergenic
948845650 2:240681695-240681717 CAGACGGAGGGTCTGAGTGGAGG + Intronic
948848205 2:240693035-240693057 CAGACGGAGGGTCTGAGTGGAGG - Intronic
948939118 2:241187481-241187503 CAGGATGAGGGTCCGCCTGGAGG + Intergenic
1168936888 20:1673353-1673375 TAGGATGAGGCTCAGAGAGGAGG + Intergenic
1168986478 20:2053282-2053304 AAGGCTGAGTATCAGAGAGGTGG - Intergenic
1169280467 20:4262818-4262840 CAGGCTGAGGGTCAGGGTGCAGG + Intergenic
1170399897 20:15970562-15970584 CAGGCTGTGGTACAGAGAGGAGG + Intronic
1171975740 20:31593680-31593702 CAGGCTGGGTGCCAGAGAGGAGG + Intergenic
1173279660 20:41617781-41617803 CAGGCTGCTGTTCCGGGAGGGGG - Intronic
1174304884 20:49608137-49608159 CAAGCTGAGGCTCGGAGAGGTGG - Intergenic
1175285268 20:57833492-57833514 CAGGTTGGGGGTCCCTGAGGAGG + Intergenic
1175358678 20:58389738-58389760 GAGGCTGGGGGTCGGGGAGGAGG - Intronic
1175967016 20:62664840-62664862 GAGACTGAGGGTCAGAGTGGTGG - Intronic
1175967026 20:62664885-62664907 GAGACTGAGGGTCAGAGTGGTGG - Intronic
1176007833 20:62875806-62875828 AAGGCTGTAGGTCCGAGAGCAGG + Intergenic
1176050734 20:63118180-63118202 CAGGGTGGGGGTCAGAGACGTGG - Intergenic
1178383245 21:32129134-32129156 TTGGCTGAGGGTCAGGGAGGTGG - Intergenic
1179802162 21:43816256-43816278 GTGGCTGAGGGTCCTGGAGGCGG - Intergenic
1179874642 21:44261807-44261829 CAGGCTCAGGGTCCCCGGGGAGG + Exonic
1181762400 22:25067374-25067396 CAGACTGATGGCCCGGGAGGCGG - Intronic
1182063765 22:27416488-27416510 CAGGCCGGGGGTGCCAGAGGGGG - Intergenic
1182097516 22:27636088-27636110 CAGGCTGAGGATCCCAGAGACGG - Intergenic
1183205094 22:36413421-36413443 CAGACTGTGGGCCCCAGAGGAGG - Intergenic
1183218473 22:36496538-36496560 CAGGCAGAGGGCAGGAGAGGGGG + Intronic
1183581925 22:38731448-38731470 CAGGGTCAGGGCCCGAGATGGGG - Exonic
1183606889 22:38871431-38871453 GGGGCTGGGGGCCCGAGAGGGGG + Intronic
1183711383 22:39505764-39505786 CAGATTGAGGGACCGAGGGGTGG + Intronic
1183943650 22:41311232-41311254 GATGTTGAGGGTCCGAGAGGTGG + Intronic
1184296638 22:43529260-43529282 AAGGCTGATGATCAGAGAGGTGG + Intronic
1184439026 22:44497681-44497703 CAAGCCGAGGGCCCGAGAGAGGG + Exonic
1184467906 22:44679746-44679768 CAGACTGAGTGTCCCAGAGCGGG - Exonic
1184685886 22:46096136-46096158 CAGGCTGCTGGTGGGAGAGGTGG + Intronic
1184786352 22:46673856-46673878 CAGACTGAAGGCCCGTGAGGGGG + Intronic
1185108258 22:48886248-48886270 GAGACTGAGGGTCAGAGTGGAGG + Intergenic
1185176873 22:49332864-49332886 GAGGCTGAGGGACAGAGAAGAGG + Intergenic
1185398907 22:50605959-50605981 CAGGCTGAGGGTCCGCTTGGCGG + Intronic
951666136 3:25125941-25125963 CAGACTGAGGGTGGGAGAGAGGG + Intergenic
952338237 3:32423437-32423459 CAGGGGTAGGGGCCGAGAGGAGG + Intronic
953535011 3:43770608-43770630 CAGGCTGAGGGCCCCAGGGTTGG - Intergenic
954556305 3:51520137-51520159 TGGGCTGAGAGTCCCAGAGGAGG - Intergenic
954706300 3:52482419-52482441 CAGGCCCAGGGGCTGAGAGGAGG + Intronic
954803997 3:53204715-53204737 CAGGCTGTGGGACAGGGAGGGGG + Intergenic
955086850 3:55710885-55710907 GAGACTGAGGCTCCAAGAGGGGG + Intronic
963603056 3:147393572-147393594 CCGGCTCAGGGTCGGAGAGGAGG - Intronic
963973287 3:151453020-151453042 AGGGCTGAGGGTTGGAGAGGAGG + Intronic
963986379 3:151599265-151599287 GGGGCTGAGGGTTGGAGAGGAGG + Intergenic
965052988 3:163675438-163675460 CAGGCTGTGGGTCAAAGAGGGGG + Intergenic
966130148 3:176628216-176628238 CAGGCTGAGGGTGGAAGAGAGGG + Intergenic
966419270 3:179721431-179721453 CAAGCTGAGGGTCAGTGAGTGGG + Exonic
968533946 4:1112618-1112640 CAGGCTGCGGGTCCGCCTGGAGG - Intronic
968632834 4:1661103-1661125 CGGGCTGAGGGGCGGAGAGCAGG - Intronic
968805239 4:2767778-2767800 GAGGCCGAGGGTCTGAGAGCTGG - Intergenic
969525599 4:7702461-7702483 GAGGCTGAGGCTCTGAGGGGTGG - Intronic
969610612 4:8225814-8225836 CAGGCAGGAGGTCCCAGAGGAGG + Intronic
970194051 4:13539237-13539259 CAGGCAGGGGGCCCGAGAGTGGG + Intergenic
975642402 4:76513260-76513282 CAGGCTGAGTGTGGGAGAAGGGG + Intronic
975645669 4:76543307-76543329 GAGGCTGAGGGTGGTAGAGGAGG + Intronic
976515029 4:85955231-85955253 CATGCTGAGGGTCGGGGTGGGGG - Intronic
976604276 4:86968159-86968181 CTGCCTGAGGGTAAGAGAGGAGG - Intronic
976830368 4:89307977-89307999 CAGCCTGAGCATCCGAGAGAGGG + Exonic
976997278 4:91450586-91450608 CAGGCTGAAGTTCAGAGAGAAGG + Intronic
980991346 4:139741037-139741059 GATGCTGAGGCTCTGAGAGGAGG + Intronic
985909426 5:2867273-2867295 CAGGCAGAGGGTCCGTGGAGAGG - Intergenic
985996986 5:3602595-3602617 CAGGCTGGGGGTGCGAGCGGAGG - Intergenic
988065265 5:26224110-26224132 AAGTCTGAGGGTCCCAGAGCTGG - Intergenic
994514464 5:100753127-100753149 CAGGCTGAGGTTCCAAGAGTGGG + Intergenic
994900127 5:105760593-105760615 CAGGCTGCTGGTCGGAGTGGGGG - Intergenic
997472185 5:134123253-134123275 CAGGCTGAGGGCCCAAGGGTAGG - Intronic
998076408 5:139240220-139240242 CAGGCTGAGGGTGAGGGTGGGGG + Intronic
998134522 5:139667720-139667742 CAGACTGAGGGTCAGAGGGCAGG + Intronic
998140805 5:139698289-139698311 CCGGCTGAAGGTCAGAGAGTGGG - Intergenic
998367035 5:141638222-141638244 CAGGCTGTGGTTCCGACATGAGG - Exonic
999277925 5:150344296-150344318 CAGGCAGAAGGTCAGACAGGAGG - Intergenic
1000538047 5:162504418-162504440 CAGGCTTAGGGAAGGAGAGGAGG - Intergenic
1001017672 5:168156128-168156150 CAGGCTGAGGCTCAGAGAGGTGG + Intronic
1001744948 5:174085286-174085308 GAGACTGAGGCTCAGAGAGGTGG + Intronic
1003015834 6:2466830-2466852 CAGGCTGAGGATCGGCCAGGTGG + Intergenic
1004250943 6:14022738-14022760 CAGGGTGAGGGACCAAGGGGAGG - Intergenic
1005836549 6:29713827-29713849 CTGACTGAGGGTCTGAGAGCAGG - Intergenic
1005845219 6:29771794-29771816 CTGGCTGAGTGTCCGAGAGCAGG - Intergenic
1006020359 6:31114324-31114346 CAAGCAGAGGCTCTGAGAGGTGG + Intergenic
1006066262 6:31464512-31464534 CTGGCTGAGGGTCTGAGAGCAGG + Intergenic
1006269184 6:32950816-32950838 CAGGGTGAGGTTCAGGGAGGTGG + Intronic
1007178911 6:39914595-39914617 CAGGCTGGGGGTGCTGGAGGGGG - Intronic
1007576634 6:42929411-42929433 CGGGCTGCGGCTGCGAGAGGAGG + Exonic
1009842360 6:69093207-69093229 CAGGCTAAGGGAGAGAGAGGTGG + Intronic
1011258561 6:85449587-85449609 CGAGCTGAGGGGCAGAGAGGAGG - Intronic
1011762841 6:90586957-90586979 CAGGCTGAGGGTCGGTCCGGAGG - Exonic
1013392790 6:109703688-109703710 CAGTCTCAGGGACAGAGAGGGGG - Intronic
1015163170 6:130175313-130175335 CAGGCTGAGGGCCCGTGGGAGGG - Intronic
1017021294 6:150142690-150142712 CAGGTGGAGGCCCCGAGAGGCGG + Intergenic
1018093216 6:160363135-160363157 CAGGTGGAAGGTCCGAGAAGAGG + Intronic
1018620770 6:165727392-165727414 CTGGCTGAGGGAGAGAGAGGAGG + Intronic
1019291489 7:252640-252662 CAAGGTGAGGGGGCGAGAGGTGG + Intronic
1019318816 7:405668-405690 CAGGCCCAGGGCCTGAGAGGCGG - Intergenic
1019608280 7:1921141-1921163 CACGCTGCGGGTCTGAGACGTGG + Intronic
1020005452 7:4781669-4781691 CAGGCTGAGGCTGTCAGAGGGGG - Exonic
1020111898 7:5452175-5452197 GAGACTGAGGCCCCGAGAGGTGG - Intronic
1023882525 7:44328354-44328376 CAGGCTGTGGTTCCCAGAGCAGG + Intronic
1023938865 7:44757597-44757619 CAGCCTGAGGGCCTGGGAGGAGG + Intronic
1024512721 7:50216084-50216106 CAGGCACAGGGTCCTAGAGGAGG - Intergenic
1025936194 7:66039599-66039621 CAGGATGAGGGATGGAGAGGGGG + Intergenic
1025947973 7:66119304-66119326 CAGGGTGAGGGATAGAGAGGGGG - Intronic
1026542779 7:71295331-71295353 CAAGCTGAGGGTCCTCAAGGTGG - Intronic
1026883513 7:73922151-73922173 GAGGCTGACGGTCCAACAGGCGG + Intergenic
1029727364 7:102415929-102415951 GAGGCTGAGGGACAGAGAGCTGG - Intronic
1031568731 7:123331017-123331039 CAGTCTGTGGGTCCCAGTGGTGG - Intergenic
1031810710 7:126364598-126364620 CAGGCTAAGGGTCGTAGAGATGG + Intergenic
1034431458 7:151043324-151043346 GTGGCTGAGGGACCCAGAGGTGG + Intronic
1034490148 7:151388772-151388794 CAGGCTGACGGTCGGAGGCGGGG + Intronic
1035198073 7:157239816-157239838 CAGGCTGCGTGTCCAAGAAGAGG + Intronic
1035469291 7:159099525-159099547 CAGGCTGGGGCTCAGAAAGGAGG + Intronic
1036009555 8:4706733-4706755 GAGGCAGAGGGTCAGAGAGAAGG + Intronic
1037491659 8:19402164-19402186 CAGGCCTAGGGGCCCAGAGGTGG + Intergenic
1038205141 8:25458443-25458465 CAGGCTGAGGAGCCTAGGGGCGG - Exonic
1039889439 8:41674122-41674144 GAGGCTGAGGCCCCGAGCGGAGG - Intronic
1041705977 8:60846810-60846832 CTGGCTGAGGGTCCTTGAGGAGG - Intronic
1042483181 8:69325678-69325700 CAATCTGAGGGTCCTAGAGCTGG + Intergenic
1042963803 8:74329886-74329908 CAGGCTGAGGCTCTGTGGGGAGG - Intronic
1044586016 8:93869755-93869777 CCGGCTGAGCGTCCCAGAGCTGG - Intronic
1044873823 8:96645238-96645260 CAGGCCGCGGGGCCGAGAGGCGG - Exonic
1047499496 8:125430687-125430709 CTGGCTGTGCGTCCGGGAGGCGG - Exonic
1049194314 8:141307443-141307465 CAGGCTGGGGGTCCGAGGCGGGG + Intronic
1049256709 8:141618044-141618066 CAGGGTTAGTGCCCGAGAGGTGG - Intergenic
1049482361 8:142832613-142832635 GAGGCTGGGGGTCTGAGTGGAGG - Intergenic
1049936436 9:504959-504981 CTGGGGGGGGGTCCGAGAGGTGG + Intronic
1052345087 9:27401260-27401282 CAGGCTGAGGGTGCCAGCTGGGG - Intronic
1052560723 9:30079577-30079599 GGGGCTGTGGGGCCGAGAGGAGG + Intergenic
1053073793 9:35116118-35116140 AAGGCGGAGAGACCGAGAGGAGG - Intronic
1053209963 9:36219280-36219302 CAGGCAGAGGGTCCACGAGAGGG - Intronic
1053467140 9:38316809-38316831 GAAACTGAGGGTCAGAGAGGAGG - Intergenic
1056811928 9:89771733-89771755 CAGGCTGAGGGTGGAAGATGGGG + Intergenic
1057057997 9:91978516-91978538 CAGGCTTTGTGTCTGAGAGGTGG - Intergenic
1057814572 9:98285160-98285182 CAGGCTGAGGGCCGGAGGGCTGG - Intergenic
1057900310 9:98943514-98943536 GAGACTGAGGCTCAGAGAGGTGG - Intronic
1058416365 9:104793118-104793140 CTGGTTGAGGGTCACAGAGGAGG - Intronic
1059191835 9:112333835-112333857 CGGGCCGAGGGGCCGAGAGGCGG - Intergenic
1060172612 9:121474234-121474256 AAGGCAGAGGGTCTGAGAGATGG - Intergenic
1060479443 9:124009348-124009370 TGGGCTGCTGGTCCGAGAGGTGG + Intronic
1060828277 9:126698726-126698748 CAGGCAGAGGGCCCCAAAGGTGG - Exonic
1060874492 9:127071982-127072004 AAGGCTGAAGGTGGGAGAGGAGG - Intronic
1061242351 9:129381973-129381995 CAGACTAGGGGTCTGAGAGGTGG - Intergenic
1061425972 9:130498697-130498719 AAGGCTGAGGCTCCGAGTGCAGG + Intronic
1061434439 9:130552166-130552188 CAGGCTGAGGATCCCTGTGGGGG + Intergenic
1062016365 9:134293217-134293239 CAGGCTGGGGCTCCTGGAGGGGG + Intergenic
1062196894 9:135279406-135279428 GAAGCTGAGGCTCAGAGAGGTGG + Intergenic
1062272001 9:135714074-135714096 CAGCCTGAGGGTCTGAGACGGGG + Intronic
1062305935 9:135907244-135907266 CCGGCTGCGGGGCCGAGTGGTGG - Intergenic
1190055178 X:47177306-47177328 GAAGCTGAGGCTCAGAGAGGTGG + Intronic
1192594297 X:72389906-72389928 CAGGCTGAGGGTACCATGGGGGG + Intronic
1193017328 X:76750086-76750108 CAGGCTGTGGGCCCCAGTGGTGG - Intergenic
1195217575 X:102715499-102715521 CAGGCCCAGGGCCAGAGAGGAGG + Exonic
1195349764 X:103985166-103985188 CATGCTGGGGGTCAGAGGGGAGG - Intergenic
1195357679 X:104053673-104053695 CATGCTGGGGGTCAGAGGGGAGG + Intergenic
1198087499 X:133294555-133294577 CAGGCTGATGGTCCAAAGGGTGG + Intergenic
1199642896 X:149881259-149881281 CGGGCTCAGGGTCTGTGAGGAGG + Exonic
1199951983 X:152714656-152714678 CAGGCGCAGGCTCCGTGAGGAGG + Exonic
1199954622 X:152733833-152733855 CAGGCGCAGGCTCCGTGAGGAGG + Intronic
1199957700 X:152753792-152753814 CAGGCGCAGGCTCCGTGAGGAGG - Exonic