ID: 1091983173

View in Genome Browser
Species Human (GRCh38)
Location 12:4883065-4883087
Sequence TAGTTATTGCAGATGAAACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091983173_1091983176 8 Left 1091983173 12:4883065-4883087 CCACGTTTCATCTGCAATAACTA No data
Right 1091983176 12:4883096-4883118 ATGAGGAGTTCTTGGAAAGAAGG No data
1091983173_1091983174 -9 Left 1091983173 12:4883065-4883087 CCACGTTTCATCTGCAATAACTA No data
Right 1091983174 12:4883079-4883101 CAATAACTAAATCATCTATGAGG No data
1091983173_1091983179 26 Left 1091983173 12:4883065-4883087 CCACGTTTCATCTGCAATAACTA No data
Right 1091983179 12:4883114-4883136 GAAGGAGAAGAGAAAGGATAGGG No data
1091983173_1091983178 25 Left 1091983173 12:4883065-4883087 CCACGTTTCATCTGCAATAACTA No data
Right 1091983178 12:4883113-4883135 AGAAGGAGAAGAGAAAGGATAGG No data
1091983173_1091983177 20 Left 1091983173 12:4883065-4883087 CCACGTTTCATCTGCAATAACTA No data
Right 1091983177 12:4883108-4883130 TGGAAAGAAGGAGAAGAGAAAGG No data
1091983173_1091983181 28 Left 1091983173 12:4883065-4883087 CCACGTTTCATCTGCAATAACTA No data
Right 1091983181 12:4883116-4883138 AGGAGAAGAGAAAGGATAGGGGG No data
1091983173_1091983175 0 Left 1091983173 12:4883065-4883087 CCACGTTTCATCTGCAATAACTA No data
Right 1091983175 12:4883088-4883110 AATCATCTATGAGGAGTTCTTGG No data
1091983173_1091983180 27 Left 1091983173 12:4883065-4883087 CCACGTTTCATCTGCAATAACTA No data
Right 1091983180 12:4883115-4883137 AAGGAGAAGAGAAAGGATAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091983173 Original CRISPR TAGTTATTGCAGATGAAACG TGG (reversed) Intergenic
No off target data available for this crispr