ID: 1091985417

View in Genome Browser
Species Human (GRCh38)
Location 12:4907318-4907340
Sequence CAGATCATGCAGGGCCTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 5, 3: 57, 4: 308}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091985417 Original CRISPR CAGATCATGCAGGGCCTCTA AGG (reversed) Intergenic
901193684 1:7427825-7427847 CAGACATTGCAGGTCCTCTAGGG + Intronic
901702898 1:11054871-11054893 CACATCATTCAGGGCCTGGAGGG + Exonic
903926027 1:26831373-26831395 CAGATCATGCCTGGCCTAGAAGG + Intronic
904540628 1:31230528-31230550 CTGCTCATTCAGTGCCTCTAGGG + Intronic
904730430 1:32586788-32586810 CAGATCATATAGGGCCTTTTAGG + Intronic
904930910 1:34086845-34086867 TAGATCCTGCAGGGCCTCATAGG - Intronic
905280624 1:36846755-36846777 CAGACCATGCAGAGCCTTTTGGG + Intronic
905341538 1:37281797-37281819 CAGATTATGCAGGGCCTGGGAGG - Intergenic
905556448 1:38888994-38889016 CAGATTATGTAGGGTCTATATGG + Intronic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
906243852 1:44259435-44259457 CAGCCCATGCAGGACCTCAAAGG + Intronic
906469174 1:46113225-46113247 CAGATCATGAAAGGCCCCGAAGG - Intronic
906642125 1:47447464-47447486 CAGAGCTTGCAGGGTCTCCAAGG + Intergenic
906705486 1:47891946-47891968 CAGATTATGCAGAGGCTCTTAGG + Intronic
906784017 1:48598116-48598138 CAGATCACACAGGGCCTTGAAGG + Intronic
906824068 1:48959864-48959886 CAGATCATGTAGGGCCTTGTAGG + Intronic
907324248 1:53626478-53626500 CAGGTCAGGGAGGGCCTCCACGG - Intronic
913384300 1:118242476-118242498 CAGAGCATGCATTGCCCCTAAGG - Intergenic
915900337 1:159842119-159842141 CAGATCATGCAGGGTCTGATAGG + Intronic
917063556 1:171067089-171067111 CAGATCCTGCATGGCCTCAAAGG - Intergenic
917739069 1:177945817-177945839 CAGAACAGGGAGGGCCTCTAGGG + Intronic
918119097 1:181521970-181521992 CACATCATTCAGGGCCTCGTTGG + Intronic
918325346 1:183404655-183404677 CACATCATGAGGGGCCTCCAAGG - Intronic
918327211 1:183421320-183421342 CAGATCATACAGGGCCTTGTAGG + Intergenic
918413264 1:184282470-184282492 CAGATCCTGCAGGGCCTTTCAGG + Intergenic
920844122 1:209579249-209579271 CAGATCGTGCAAGGCCTTGAAGG - Intergenic
922011613 1:221594431-221594453 CAGATTACGCAGGGCCTCGGAGG + Intergenic
922366708 1:224872039-224872061 CAGATTCTGCAGGGCCTTGAAGG + Intergenic
922429080 1:225529220-225529242 CAGATCATGCAGGACCTTGCAGG - Intronic
924283871 1:242465503-242465525 AAGATCATGCAGAGCCTCCTGGG - Intronic
924467988 1:244315380-244315402 CACACCATGCAGGGCCAATAGGG + Intergenic
1062855638 10:778256-778278 CAGCTCATGCTGGGCCTGTGGGG - Intergenic
1065626970 10:27639585-27639607 AAGATCATGCAGAGCCTCGTAGG + Intergenic
1065679196 10:28211839-28211861 CAGATCACACAGGGCCTGAAAGG + Intronic
1067462666 10:46469148-46469170 CTGAGCTTGCAGGGCCTCTTAGG - Intergenic
1067624529 10:47915489-47915511 CTGAGCTTGCAGGGCCTCTTAGG + Intergenic
1069173363 10:65260485-65260507 CAGATCAGGCAGGGCCTTACAGG + Intergenic
1070526491 10:77300019-77300041 CAGCTCATGCTGAGCCTCTGTGG + Intronic
1070658464 10:78287619-78287641 CAGATCTTGCAGGGACTTCATGG - Intergenic
1072310307 10:94148047-94148069 CAGATCATGCAGTTTCTATATGG - Intronic
1072978364 10:100078837-100078859 GAGATCACGCAGGGCCTCATAGG - Intronic
1073559808 10:104487104-104487126 CAGACCATGCAGAGCCTGAATGG + Intergenic
1074726533 10:116315897-116315919 CAGATCCAGCAGGGCCTTGAAGG - Intergenic
1075258041 10:120940618-120940640 CAGAGCACGCAGGGCCTTGATGG - Intergenic
1075462524 10:122627018-122627040 CAGATCATTCAGGGCCTTGTGGG + Intronic
1075552010 10:123399844-123399866 CAGAGCGTGCAGGGCCTCACAGG - Intergenic
1075817936 10:125280120-125280142 TAGATAACGCTGGGCCTCTAGGG + Intergenic
1080580369 11:33637445-33637467 CAGATCATGCAGGGTCTTAAAGG - Intronic
1084977538 11:72810860-72810882 CAGATCAAGCAGGGCCTTGAAGG + Intergenic
1085063697 11:73472456-73472478 CAAATCATGCAGGGCCTCATAGG + Intronic
1086169009 11:83814605-83814627 CACATAATTAAGGGCCTCTATGG - Intronic
1086182070 11:83964195-83964217 CACTTCATGCAGGGCATATAAGG - Intronic
1086513715 11:87588567-87588589 TAGACCATGCAGGGCCTTCATGG + Intergenic
1087266477 11:96067026-96067048 CAGATCTTGTAGGGCCTGTGAGG + Intronic
1091985417 12:4907318-4907340 CAGATCATGCAGGGCCTCTAAGG - Intergenic
1092391985 12:8088720-8088742 CAGATCACGCAGGGCCTTGTGGG - Intronic
1094053983 12:26249835-26249857 CAGATCTTCCAAAGCCTCTAGGG - Intronic
1094622074 12:32089301-32089323 CTGAACATGCAGGGCCCCAAGGG - Intergenic
1095700504 12:45186220-45186242 CAGATCATGTAGGGCCTTACAGG + Intergenic
1095909270 12:47409372-47409394 CAGATCATGGAGGGCCTGGAAGG - Intergenic
1097574744 12:61377438-61377460 AAGATCTTGCAGGGCCTTTTCGG + Intergenic
1097588508 12:61544363-61544385 CAGCTCATGCAAAGGCTCTAAGG + Intergenic
1098216946 12:68230725-68230747 AAGATCATGCAGAGCCTTTTAGG + Intergenic
1099203363 12:79700875-79700897 CAGATCATACAGGGTCTTAAAGG - Intergenic
1099210901 12:79787267-79787289 CAGATCATGCAGTGCCTTATAGG - Intronic
1100052920 12:90471990-90472012 CCACTCATGCAGGGCCTCTCAGG - Intergenic
1100857864 12:98774084-98774106 CAGATCAAGCAAGGCATCCAAGG - Intronic
1101415303 12:104503657-104503679 CCAGTCCTGCAGGGCCTCTAGGG - Intronic
1102478489 12:113204275-113204297 CAGATCACACAGGGCCTTTGAGG - Intronic
1103252086 12:119508681-119508703 CAGAGCACGCAGGGCCTTTGTGG + Intronic
1103265938 12:119630109-119630131 CAGAGGATGTAGGGCCTGTAAGG - Intronic
1103813545 12:123634818-123634840 CAGGTCATGCAGGGCCTTATTGG + Intronic
1103898448 12:124289962-124289984 CAGCTCAGACAGGGCCTGTAAGG + Intronic
1104657160 12:130581900-130581922 CAGGTCATGCAGAGCCTTTCGGG - Intronic
1108126939 13:47254853-47254875 CAGATCATGTTGGGCCTTGAAGG + Intergenic
1108161549 13:47645463-47645485 CAGATCATGCAGGGCCCTGTAGG - Intergenic
1108703707 13:52965977-52965999 CAGGTCAGGCAGGGCCTCATAGG - Intergenic
1110145740 13:72188207-72188229 CAGACCATGCAGGGTCTTAAAGG - Intergenic
1114620000 14:24089993-24090015 CAGATCATGCAGAGCCTGGGAGG + Intronic
1117611160 14:57484728-57484750 CAGGTCATGCAGGGCCTGACAGG + Intronic
1118221238 14:63856195-63856217 CAGATCATGCAGGGCCTTTCTGG + Intronic
1120013670 14:79445814-79445836 CAGATCATGGAGGGCCTTTGGGG + Intronic
1120218234 14:81704005-81704027 GAGAGCATGGAGAGCCTCTAGGG - Intergenic
1121240614 14:92427407-92427429 CAGACCGTGCAGGGCCTTGAAGG + Intronic
1121421604 14:93819420-93819442 CAGATCAGGAAAGGCCTCTTGGG - Intergenic
1121691931 14:95884255-95884277 CAGATCGTGCAGGGCCCTGAGGG - Intergenic
1121752101 14:96365506-96365528 CACATCATGTAGGGCCTCGTAGG + Intronic
1122286466 14:100655379-100655401 CAGAACATGCAGGGCCTCCTTGG - Intergenic
1124321986 15:28720799-28720821 CAGACCATGCAGCACCTCTCTGG + Intronic
1124523086 15:30422641-30422663 CAGACCATGCAGCACCTCTCTGG + Intergenic
1124535580 15:30543575-30543597 CAGACCATGCAGCACCTCTCTGG - Intergenic
1124763074 15:32464021-32464043 CAGACCATGCAGCACCTCTCTGG + Intergenic
1124775553 15:32585038-32585060 CAGACCATGCAGCACCTCTCTGG - Intergenic
1125102745 15:35933822-35933844 CAGATCATCCAGGGCCTTGTTGG + Intergenic
1125306356 15:38320392-38320414 CAGCTCATGCAGGGCCTAGTAGG + Intronic
1125522039 15:40353699-40353721 CAGAACATGCAGGACCACTCAGG + Intronic
1125596684 15:40891767-40891789 AAGAGCATGTAGGACCTCTAAGG - Intergenic
1125841612 15:42806502-42806524 CAGATAATGCAGGGCCTTGTAGG - Intronic
1126559227 15:50025333-50025355 CAGACCCTGCAGGGCCTTCAAGG - Intronic
1127440549 15:59002714-59002736 CAGATCAGGTAGAGCCTGTAGGG - Intronic
1128206593 15:65858209-65858231 CAGATCTTGAAGGGCCTCATGGG - Intronic
1129592847 15:76932199-76932221 CAGATCATGGAGGGTGTGTAGGG + Intronic
1129624534 15:77182792-77182814 CAGATCATGCAAGGCCTTTTAGG + Intronic
1130688135 15:86057049-86057071 CAGACCATAGAGGGCCTCCAAGG - Intergenic
1131376117 15:91924965-91924987 CAGGTCATCCTGGGCCTCTCTGG - Intronic
1134036155 16:11032830-11032852 CAGGTCATGAAGGGCCTTGAAGG + Intronic
1135846147 16:25920365-25920387 CAGATCATGGAGGGCCCCGTAGG - Intronic
1136056730 16:27695311-27695333 CAGGTCATGCAGGGCCTTGCAGG - Intronic
1136169081 16:28477423-28477445 CAGTTCATGGAGGGTCTCTGGGG + Exonic
1136657926 16:31723606-31723628 CAGATCACGCAGGCCCTCACAGG - Intronic
1136674213 16:31885506-31885528 CAGATCAAGCAGGCCCTCACAGG - Intronic
1137343625 16:47634818-47634840 TAGATCATGGAGGGCCTCTTGGG + Intronic
1137696440 16:50465118-50465140 CTGATCCTGCAGGGACTCTCAGG - Intergenic
1138378613 16:56584538-56584560 CAGGTCATGTAGGGCCTGAATGG + Intergenic
1138679525 16:58674955-58674977 CAGATCCTGTTGGGCCTCGAGGG - Intronic
1139477596 16:67210413-67210435 CAGAGCCTGCAGGGCCTCGGGGG + Exonic
1139607908 16:68033012-68033034 CTGATCATGCAGGGCCTTGTGGG + Intronic
1139957912 16:70701874-70701896 CAGAGCAGGCAGAGCCTCTAGGG - Intronic
1141735634 16:85850602-85850624 CAGATCATGCAGACGCACTATGG - Intergenic
1142501702 17:336713-336735 CAGATCATGGACGGCCTTGAGGG - Intronic
1143971815 17:10801389-10801411 CAGATCTGGCAGGGCCTCGAGGG - Intergenic
1144444606 17:15315301-15315323 CAGATCATGCAGGGCCCTAATGG + Intronic
1145842042 17:28003400-28003422 CAGATCATGTAGGGCCCTAAAGG + Intergenic
1146791803 17:35755074-35755096 TAGATCATGCAGGGCCTTGTAGG + Intronic
1146937209 17:36819323-36819345 CAGAGCAGGCAGGGCCTCCGAGG + Intergenic
1147165187 17:38589353-38589375 CAGCTCATGCAGGGCATCTGGGG + Intronic
1149418507 17:56485504-56485526 TAGACCATGCAGGGCCTCACAGG + Intronic
1150896020 17:69211779-69211801 AAGATCATTCAGGGCCACTATGG - Intronic
1150944671 17:69731965-69731987 CAGAACCTGCAGGGCCTTTGGGG + Intergenic
1152264798 17:79288031-79288053 CAGAGCAGGCAGGGCCTCGTGGG - Intronic
1152687734 17:81702911-81702933 CAGAACAGGCAGAGCCTCCAAGG - Intronic
1152799910 17:82326049-82326071 CAGGGACTGCAGGGCCTCTAAGG + Intronic
1153161368 18:2207913-2207935 CAGATCATGCTGAGCTTCTTTGG - Intergenic
1153200602 18:2643684-2643706 AAGATCATGCAGGGCCTTGGAGG - Intergenic
1155442937 18:25880976-25880998 CAGATCATGTAGGGTCTAGAGGG + Intergenic
1158186936 18:54781068-54781090 GAGATAATGCAGGGCAGCTAAGG - Intronic
1159563726 18:70024184-70024206 CAGGTCATGTAGGGCCTCAGAGG - Intronic
1161239367 19:3213452-3213474 CAGGCCATGCAGGGCCTCCTGGG + Intergenic
1161490374 19:4557913-4557935 CAGGTCGTGCAGGGCCTGTTGGG - Intronic
1161621412 19:5299225-5299247 CAGGTCATGCAGGGCCTTGTGGG - Intronic
1161634238 19:5377234-5377256 CAGGTCATGCAGGGCCTTGTGGG + Intergenic
1162544698 19:11321693-11321715 CAGATCATGCAGGGCCCCGGGGG + Intronic
1162736009 19:12747530-12747552 CACATCTTGCAGGGCTTCTCGGG - Exonic
1162829965 19:13278260-13278282 CAGATCGTGCAGGGGCTTGAGGG - Intronic
1163017802 19:14467481-14467503 CAGATCTTGCAGGGCCTCGGAGG + Intronic
1164764192 19:30751121-30751143 CAGGTCTTGCAGTACCTCTATGG + Intergenic
1164825081 19:31278923-31278945 CAAATCCTGCAGGGACTCAAAGG + Exonic
1165879064 19:39030173-39030195 CAGATCATTCAGAGCTTCTCAGG - Intronic
1166634280 19:44435902-44435924 CAGATCACTCAGGGCCTCTTAGG + Intronic
1166833263 19:45651072-45651094 CATATCTTGCAGGGCCTCAAAGG + Intergenic
1167242297 19:48351550-48351572 CAGATCTTGCAGGGCCCCCCTGG - Intronic
1167325087 19:48819479-48819501 CAGATCAGGCAGGGCCTTGAAGG - Intronic
1167564535 19:50248176-50248198 CAGATCATGCAGGGTCTTAGGGG + Intronic
925283900 2:2703646-2703668 CAGCTCTTACAGGGCCTCTGTGG - Intergenic
926004451 2:9362128-9362150 CAGACCATGCATGGCCTCCCTGG - Intronic
927136575 2:20101076-20101098 CAGATTTTGTAGGGCCTATAAGG - Intergenic
928255996 2:29723133-29723155 CAGATCCTGTGGGGCCTTTAGGG - Intronic
928440788 2:31290228-31290250 CAGGTCATGCAGGGCCTTAAAGG - Intergenic
929605379 2:43230619-43230641 CAGAGAATGCAGGGCGGCTATGG + Intergenic
931323711 2:61196908-61196930 GAGATCATAAAAGGCCTCTATGG - Intronic
931503513 2:62898094-62898116 CAGGTCACACAGGGCCTCAAAGG + Intronic
932760893 2:74438589-74438611 CAGATCATGCAGGGCCTTGAAGG - Intronic
932832159 2:75000691-75000713 CAGAATCTGCAGGGCCTCTTAGG - Intergenic
937896534 2:126980454-126980476 CAGATCTTACAGGGCCTCATGGG - Intergenic
939673546 2:145043494-145043516 GAGATCATGCAATGTCTCTAAGG - Intergenic
939901697 2:147858439-147858461 CATATCATACAGAGCCTTTAAGG - Intronic
940172592 2:150844864-150844886 CAGAATATGCTGGTCCTCTAGGG - Intergenic
941043992 2:160652296-160652318 CAGAGCATGCAGGGCCTTCTAGG - Intergenic
942111349 2:172685391-172685413 CAGAACATGCAGAGCCTTGAAGG - Intergenic
942428134 2:175880757-175880779 TAGATCATGCAGGACCTTCACGG + Intergenic
944325777 2:198401825-198401847 CAGATCATGCAGGACCTTGTAGG - Intronic
944395529 2:199262213-199262235 CAGATCATGTAGGGCCTTGCAGG + Intergenic
944505898 2:200410480-200410502 CAGATCGTACAGGGCCTACAAGG - Intronic
945679785 2:212899895-212899917 CAGATCATTCAGGGCCTTATGGG + Intergenic
946333979 2:219025532-219025554 CAGGTCAGGCAGGGCTTCTAAGG + Intronic
947996891 2:234535347-234535369 CAGAACATGCAGGGCCGATGGGG + Intergenic
948590494 2:239046840-239046862 CAGATCCTGCAGCGCCTCCCTGG - Intergenic
948900433 2:240954077-240954099 CAAAACAAGCAGGGCCTCAAGGG + Intronic
948999106 2:241602186-241602208 CAGAACAGGCAGGTGCTCTATGG + Intronic
1168789187 20:564475-564497 CAGATCACATAGGGCCTCAAAGG + Intergenic
1168958152 20:1849054-1849076 CAGATCACACAGGGCCTTGAAGG - Intergenic
1170464442 20:16610140-16610162 CAGATCATGTAAGGCCTTTGTGG - Intergenic
1170568884 20:17621885-17621907 CAGAGCCAGCAGGGCCTCCATGG + Exonic
1171152030 20:22835697-22835719 CAGATCCTGCAGGGCCTTGCAGG + Intergenic
1171721589 20:28569114-28569136 CAGAGCATCCAGGTCCCCTATGG + Intergenic
1171862522 20:30413672-30413694 CAGAGCATCCAGGTCCCCTATGG - Intergenic
1172029784 20:31973757-31973779 GAGGTCATGCAGGGCCTCAGAGG + Intronic
1172223662 20:33290220-33290242 CAGATCATACAAGGCCTCTTGGG + Intronic
1172441986 20:34972208-34972230 CAGATCATTCAGAGCCTTGAAGG - Intergenic
1172518223 20:35550651-35550673 CATATCATGCAGGGCTTGCAGGG + Intronic
1172807105 20:37619913-37619935 CAGAACATGCAGGACCTCGTAGG + Intergenic
1173135702 20:40436971-40436993 CAGATCAAACAGAGCCTCTTAGG + Intergenic
1173209269 20:41019484-41019506 CAGTTCATGCAGGGTCTCTAAGG - Intergenic
1173587446 20:44193615-44193637 CAGATCATGGAGGGCCTGGTAGG - Intergenic
1173688529 20:44940965-44940987 CAGATCATGCAGGGTCTCCTAGG - Intronic
1173833034 20:46104955-46104977 CAGATCTCGCAGGGCCTTGAAGG - Intergenic
1174077204 20:47946124-47946146 CAGATTGTGCAGGGCCTCTCGGG + Intergenic
1174199675 20:48798484-48798506 CAGAGCATGCAGGGCCTTCCAGG - Intronic
1174421978 20:50405237-50405259 CAGATCTTGCAGAGCCTCCTAGG - Intergenic
1174540899 20:51288548-51288570 CAGCCCTTGAAGGGCCTCTATGG + Intergenic
1175497617 20:59425679-59425701 CAGGTGCTGCAGGGCCTCTTGGG - Intergenic
1175995716 20:62811510-62811532 GAGCTCATGCTGGGCTTCTACGG + Exonic
1179109967 21:38437883-38437905 TAGATTTTGCAGGGCCTCTCTGG - Intronic
1180295133 22:10927772-10927794 CAGAGCATCCAGGTCCTCTATGG + Intergenic
1181275146 22:21683364-21683386 CAGAAAATGCAGGGCCTGTCTGG - Intronic
1181998363 22:26901236-26901258 CAGAGCAGGCAAGGCGTCTATGG - Intergenic
1182642481 22:31779522-31779544 CAGTTCATGCAGGGCCTTCAAGG + Intronic
1183781322 22:40000861-40000883 CAGAGCAAGAAGGGCCTCTCAGG + Intronic
1183830555 22:40416468-40416490 CAGATCATGCGTGGCCTCCTGGG - Intronic
1184608718 22:45589266-45589288 CACATCATGCTGGGACTCTGTGG + Intronic
1184637801 22:45848971-45848993 CAGATCATGCAGGGTCTTCAAGG + Intergenic
1184734186 22:46388510-46388532 CAGTCCATGCAGGGCCCCCATGG - Intronic
950062642 3:10084774-10084796 CAGATTGTGCTGGGCCTCAAAGG + Intronic
950080646 3:10219741-10219763 CAGACCATGCAGGTACTCGACGG - Exonic
950121436 3:10484643-10484665 CACATCCTGCAGGGCCCCCATGG + Intronic
950564782 3:13762108-13762130 CAGATCATGCGGCCACTCTAAGG - Intergenic
951277798 3:20710949-20710971 CAGATCATGCAAGGCCTTGTAGG + Intergenic
953368765 3:42369755-42369777 CAGATCATGCAGGGGTTGTGGGG - Intergenic
953581495 3:44161162-44161184 CAGATCATGTAGGCCTTATAAGG - Intergenic
954473081 3:50715783-50715805 AAGATCATGGAGGGCCTTAAAGG + Intronic
955040249 3:55309691-55309713 CAGATCACCTAGGGCCTCAAAGG + Intergenic
955070888 3:55571695-55571717 CACATCATGCAGGACCACTCAGG - Intronic
955509156 3:59662134-59662156 CAGATCATGCAGACCCTCACTGG + Intergenic
957849449 3:85787799-85787821 CAGATCATGCAGGACTTGTTAGG - Intronic
959689431 3:109182632-109182654 CAGATCATGCAGGGCCTTGAAGG - Intergenic
959833913 3:110896302-110896324 CAGATCATCAAGGACCTGTAGGG - Intergenic
960486954 3:118264949-118264971 CAGATCATGTAGGGCCTTTCAGG + Intergenic
961165360 3:124759877-124759899 CTGAGCAGGCAGGGCCTCTGGGG + Intergenic
961697012 3:128712412-128712434 CAGATAGTGCAGGGCCTTGAAGG + Intergenic
963949880 3:151187666-151187688 CAGTTCATGAAGTACCTCTAGGG - Intronic
964373950 3:156031269-156031291 CAGATCATGCAGGGCCCTGTTGG + Intergenic
964466227 3:156996442-156996464 CACATCATGCAGGGCCTTGCAGG + Intronic
965247887 3:166298937-166298959 GAGATCGTGCAGGACCTTTAAGG - Intergenic
965289500 3:166861170-166861192 GAGATCATGCAGTTCCTCTTAGG - Intergenic
966040945 3:175487099-175487121 CAGGTTTTGCAGGGCCTCTCCGG - Intronic
966058502 3:175727117-175727139 CAGATCATGCAAAGGCTCTCGGG - Intronic
966115405 3:176454725-176454747 CAGATCATGTAGAGCCTCAAAGG - Intergenic
966351327 3:179035229-179035251 CAGATCATGTAGGGCCTTATAGG - Intronic
967399369 3:189043457-189043479 CATATCATGCAGGCCCTTTATGG + Intronic
967702578 3:192610704-192610726 CAGATCTTGCAGGGCCTTGCAGG - Intronic
969174490 4:5388124-5388146 AAGATAATGCTGGGTCTCTAGGG + Intronic
970275180 4:14391972-14391994 CAGAGCATGCTGGGCCTTGAAGG - Intergenic
971181117 4:24329373-24329395 CCCATCACGCAGGGCCTCAAAGG - Intergenic
972024657 4:34361956-34361978 CAGTTCATGCTGGAACTCTAAGG - Intergenic
973628617 4:52797552-52797574 CAGAGCATGCAGGGCCTCTCAGG + Intergenic
974010092 4:56598733-56598755 CAGATCATGTAGGGCCTTGTAGG + Intronic
974125075 4:57686102-57686124 CAGATAGTGCAGGGCCTTGAAGG - Intergenic
974360246 4:60868338-60868360 CAGTTCATGTAGAGCCTCAAAGG + Intergenic
975854451 4:78608409-78608431 CAGATCATGCAGGACCTTTTTGG + Intronic
976585301 4:86790760-86790782 CAGATAATTCAGGGCCTTCAAGG + Intronic
977891679 4:102319437-102319459 CAGGTGATGCAGGTCCTGTAAGG - Intronic
979158635 4:117429864-117429886 CAGATCCAGCAGTTCCTCTAGGG + Intergenic
981010272 4:139918276-139918298 CAGACCATCCAGCGCCTCTTAGG - Intronic
981177446 4:141698632-141698654 AAGATCATTCAGGGCTACTATGG - Intronic
981422639 4:144568883-144568905 CAGAACATTCAGGGCTTCTTAGG - Intergenic
981721695 4:147808417-147808439 CAGATCATGCAGGGTCTTTCAGG + Intronic
985370783 4:189283502-189283524 CAGAGCATCCAGGTCCACTATGG + Intergenic
985426092 4:189832089-189832111 GAGCTCATCCAGGGCATCTAAGG + Intergenic
986204291 5:5609513-5609535 GAGATCAAGCAGAGCCTCTGAGG - Intergenic
986547748 5:8917684-8917706 CTAGTCATGCAGGGCCTCAAAGG + Intergenic
987783860 5:22472977-22472999 CAGATCAAGTAGGGCCTCAAAGG - Intronic
987960924 5:24807412-24807434 CAGATAATTCAGGGCCTTGAGGG + Intergenic
989100403 5:37817962-37817984 CAGGTCAGGTAGGGCCTTTAGGG - Intronic
989541905 5:42627902-42627924 CAGATCATACAGGGGCTCGAAGG + Intronic
989552707 5:42755118-42755140 CAGATGAGGCAGGGGATCTAGGG + Intergenic
991490723 5:67180398-67180420 CAGAATATGCAGGGACTCAATGG + Intergenic
991515149 5:67427034-67427056 CAGATCTTGTAGGGCCTTGAAGG - Intergenic
992040497 5:72825931-72825953 CAGATCATGTAGAGCCTCACAGG - Intronic
992716993 5:79520783-79520805 CAGATCATGCAGTACCTCTTAGG - Intergenic
994926555 5:106123145-106123167 CAGTGCATGCAGGGCCTTTAGGG + Intergenic
995095906 5:108235660-108235682 CAGATCATGCGGGGCCTTATAGG - Intronic
995132232 5:108642735-108642757 CAGATCATGCAGAGCCTTCCTGG - Intergenic
996550671 5:124726758-124726780 CAGGTCATGCAGGGCCTTGTAGG - Intronic
998529033 5:142868326-142868348 CAGACCCTGCAGGGCCTCTCAGG + Intronic
998885694 5:146691681-146691703 CAGGTCATGAAGGGCCTTTTAGG - Intronic
999412721 5:151366441-151366463 CAGCTCATGGAGGGCCTAGAAGG + Intergenic
999559162 5:152781166-152781188 CAGATCATGTAGGGCCTTGCAGG - Intergenic
1001017359 5:168153624-168153646 CAGATAATGCAGGGCCTTTGAGG + Intronic
1001264928 5:170267355-170267377 CAGCTCAGGCAGGGCCTCGCAGG - Intronic
1001517127 5:172363771-172363793 CAGATCAGGCAGGGCCTTTGGGG + Intronic
1001579119 5:172786625-172786647 CAGACTTTGCAGGGCCTCTCAGG + Intergenic
1002146992 5:177191959-177191981 CAAATCCTGCAGGGCCACCATGG - Exonic
1002853799 6:1020388-1020410 CAGCTCCTCCAGGGCCCCTATGG + Intergenic
1003236011 6:4295632-4295654 CAGATCCTACAGGGCCTGAAAGG + Intergenic
1005393584 6:25358627-25358649 CAGGTCAAGCAACGCCTCTAAGG + Intronic
1005758483 6:28946655-28946677 TAGATCATGCAGGGTCTCAGAGG + Intergenic
1007178969 6:39914937-39914959 CAGAACCTGCAAGGGCTCTACGG - Intronic
1008543614 6:52566605-52566627 CAGATCACCCAGGGCCCCTTAGG - Intronic
1009581400 6:65538787-65538809 CAGATCATGTAGGGTTTGTAAGG - Intronic
1014805788 6:125827849-125827871 CAGATCATGCAGGGCCTTCTTGG + Intronic
1015228636 6:130887519-130887541 CAGATCATGCAGGGCCTTGGAGG - Intronic
1018955545 6:168407940-168407962 CAGGGCGTGCAGGGCCTCGAAGG - Intergenic
1019375364 7:688502-688524 CAGATCACGCAGGGCCTTGCTGG - Intronic
1021442304 7:20689978-20690000 CGGTTCATGCAGGGCCTCTTAGG + Intronic
1021874190 7:25033098-25033120 CAGGTCATGCAGGGCCTGATGGG + Intergenic
1021937575 7:25646410-25646432 CACCTCATGCAGGGCCTTTTGGG - Intergenic
1022138024 7:27467399-27467421 CAGAGGATGAAGGGCCTCCAGGG - Intergenic
1022312573 7:29210948-29210970 CGGATCATGGAGGGCCTCGTAGG + Intronic
1022606271 7:31817440-31817462 CAGATCATGCAGGGCTTTGGAGG + Intronic
1022656950 7:32328446-32328468 CAGATCATGCAGGGACTTGGAGG - Intergenic
1023066687 7:36384934-36384956 CAGATCATGCATGGCCTTGTAGG + Intronic
1024672747 7:51611359-51611381 CCTTTCATGCAGGGCCTCAAAGG - Intergenic
1025248851 7:57338206-57338228 CAGATCTTGCAGAGCCTCATGGG + Intergenic
1026992388 7:74594521-74594543 CCCATCATCCAGGGCCTATATGG + Intronic
1029360975 7:100088604-100088626 CAGATCAGGCAGGGCCTTGCAGG + Intergenic
1030324501 7:108205025-108205047 CAGAGTATGCAGTGCCTCTGAGG - Intronic
1032429178 7:131847058-131847080 CACATCATGCAGGACCTCTTTGG + Intergenic
1032469059 7:132164870-132164892 GGGACCATGCAGGGCCTCTCAGG + Intronic
1033022396 7:137739525-137739547 GACCTCATGCAGGGCCTCTCTGG + Intronic
1033449137 7:141447483-141447505 CAGATCATTAAGGGCCTCAGAGG + Intronic
1036505280 8:9349238-9349260 CAGATCATGCAGGGTCTTATCGG - Intergenic
1036683816 8:10895055-10895077 CAAATCAGGGAGGGCCTCCAGGG - Intergenic
1037939988 8:22944072-22944094 CATATCATGCAGGGCCACATGGG - Intronic
1038821129 8:30952738-30952760 CAGAGCATGCAGGGCCATGAAGG + Intergenic
1039969222 8:42307325-42307347 CAGATTATGAAGGGCCTTCAGGG + Intronic
1040895725 8:52366401-52366423 CAGATCTTGTAGGGCCTCCTGGG - Intronic
1041133371 8:54728057-54728079 CAGATGATGAAGCTCCTCTAAGG + Intergenic
1042096903 8:65226144-65226166 CAGATCACGCAGGGCCTTGTAGG + Intergenic
1042150798 8:65781368-65781390 CAGATCATGCTGGACCTTTGTGG + Intronic
1042939810 8:74096282-74096304 CAGATCATGCAGAGCCTCATTGG - Intergenic
1044889826 8:96822607-96822629 CATATCATGCAGGACCTCCTGGG - Intronic
1044934473 8:97279448-97279470 CAGATCATACAGGGCCTTGCAGG - Intergenic
1045227389 8:100262568-100262590 CAGATCATGTGGGGCCTTTTGGG + Intronic
1046937179 8:119895682-119895704 CAGATCAAGCTGAGCCTCTGAGG + Intronic
1047285027 8:123480345-123480367 CAGATCATGCAGGGTCTTTGTGG + Intergenic
1047392555 8:124465255-124465277 CAGCTCATGATGGGCCTCTCTGG - Intergenic
1048573676 8:135674803-135674825 CAGATAATGCAGGGCTGATATGG + Intergenic
1048948344 8:139471738-139471760 CAGACCATGAAAAGCCTCTAAGG + Intergenic
1049790823 8:144472079-144472101 CAAGTCATGCAGGGCCCCTGGGG - Intronic
1050046960 9:1556874-1556896 CACATCCTGCAGGGCCTCCAAGG + Intergenic
1052315826 9:27115861-27115883 CAGATCAAGAAGGGCCTCACAGG + Intronic
1052973611 9:34396558-34396580 CAGACCAAGAAGGGCCTCTCTGG - Intronic
1053051920 9:34969126-34969148 CAGACCATGCAGGGCCTCACAGG + Intronic
1056693711 9:88828803-88828825 CAGTTAATGCAGGGCTTGTAAGG + Intergenic
1057304115 9:93902635-93902657 GAGGTGATGCAGGGACTCTATGG - Intergenic
1057517633 9:95735546-95735568 CAGATCAAGAAGGGCCTCCCAGG - Intergenic
1059189496 9:112310964-112310986 CATAGCATGCAGGGCCTTAACGG + Intronic
1059348245 9:113646795-113646817 CAGATCACGCAGGGCCTTGAAGG - Intergenic
1060059521 9:120446625-120446647 CAGATCAGGCAGGCTCTCAAAGG - Intronic
1061203342 9:129149505-129149527 CAGTCCATGCAAGGCCTCTAAGG - Intergenic
1062178356 9:135176722-135176744 CAGATGATGAAGGGCCTGTGAGG + Intergenic
1062199134 9:135291995-135292017 CCCATCATGCAGGTTCTCTAAGG - Intergenic
1202802015 9_KI270720v1_random:8928-8950 CAGAGCATCCAGGTCCCCTATGG + Intergenic
1185848753 X:3465284-3465306 CAGGTCATGCAGGGTGTCTGGGG + Intergenic
1186868422 X:13744733-13744755 CAAATCATGCAGGGATTCAAAGG + Intronic
1187248494 X:17575270-17575292 CAGGTCATGCAGGGCCTTGCAGG - Intronic
1187366025 X:18666506-18666528 CAGTTCCTGCAGGGCCTCGTGGG + Intronic
1189105991 X:38235819-38235841 CAGATCAAACAGGGCCTTTTTGG - Intronic
1189537986 X:41956206-41956228 CAGATCATGTAGGGCCTTGTAGG - Intergenic
1189550437 X:42087184-42087206 CAGCCCTTGCAGGGCCTTTAAGG - Intergenic
1190070260 X:47273568-47273590 AAGATCATGGAGGGGCTCTTTGG + Intergenic
1190102747 X:47534785-47534807 CAGAGCATGGAGGACTTCTAGGG + Intergenic
1190482142 X:50888202-50888224 CTGGTCATGCAAGGGCTCTATGG - Intergenic
1190486688 X:50933473-50933495 CTGGTCATGCAAGGGCTCTATGG + Intergenic
1191136667 X:57070955-57070977 CAGATGAGGCAGGGCCGCTGAGG - Intergenic
1192043020 X:67643305-67643327 CAGATCAGGCAGGTCTTCTGGGG - Exonic
1192273832 X:69610180-69610202 CAGATCATGTAGGGCCTTGTAGG + Intergenic
1192498048 X:71629373-71629395 CAGATCATGGAAGGCCTTAATGG - Intergenic
1192555211 X:72083863-72083885 CAGATCGTGCAGGGCCTTCTAGG - Intergenic
1195251443 X:103051918-103051940 CAGATCTTACAGGGCCTGAAGGG + Intergenic
1196003794 X:110813914-110813936 CAGATCATGTAGGGCTTTGAAGG + Intergenic
1197712919 X:129684952-129684974 CAGATCAGGCAGGGCCTTCTAGG + Intergenic
1197721281 X:129746422-129746444 AAGACCATGCTGGGCCTCTATGG + Intronic
1197741707 X:129900057-129900079 CAGATCATGTAGGGCCTTGTAGG - Intergenic
1197881749 X:131173841-131173863 CAGATCATGTAGGGCCTTTTAGG + Intergenic
1198257007 X:134932689-134932711 CAGATCAAGGAGGGCCTCTGCGG - Intergenic
1198320441 X:135514398-135514420 CAGATCATGCAGGGCCTAGTTGG - Intergenic
1198411346 X:136372561-136372583 CAGACCCTGCAGGGCCTCGTAGG - Intronic
1198789394 X:140327128-140327150 CAGATCATGAAGGGCCTCGTGGG + Intergenic
1198832835 X:140769276-140769298 CAGATCATGGAGGGCCTCATAGG + Intergenic
1201242953 Y:11976389-11976411 CACATCATGCAGGGCCACAGAGG + Intergenic