ID: 1091985641

View in Genome Browser
Species Human (GRCh38)
Location 12:4908911-4908933
Sequence CCTTAGAGACTCCGCAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091985632_1091985641 29 Left 1091985632 12:4908859-4908881 CCCAAGGCCGCGGGAGGAGCCAA 0: 1
1: 0
2: 1
3: 9
4: 106
Right 1091985641 12:4908911-4908933 CCTTAGAGACTCCGCAGCCCTGG 0: 1
1: 0
2: 0
3: 6
4: 118
1091985634_1091985641 22 Left 1091985634 12:4908866-4908888 CCGCGGGAGGAGCCAATCAGCGG 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1091985641 12:4908911-4908933 CCTTAGAGACTCCGCAGCCCTGG 0: 1
1: 0
2: 0
3: 6
4: 118
1091985633_1091985641 28 Left 1091985633 12:4908860-4908882 CCAAGGCCGCGGGAGGAGCCAAT 0: 1
1: 0
2: 0
3: 11
4: 88
Right 1091985641 12:4908911-4908933 CCTTAGAGACTCCGCAGCCCTGG 0: 1
1: 0
2: 0
3: 6
4: 118
1091985638_1091985641 10 Left 1091985638 12:4908878-4908900 CCAATCAGCGGCGACTCTGGGCT 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1091985641 12:4908911-4908933 CCTTAGAGACTCCGCAGCCCTGG 0: 1
1: 0
2: 0
3: 6
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091985641 Original CRISPR CCTTAGAGACTCCGCAGCCC TGG Intergenic
900487245 1:2929029-2929051 CCCCAGAGCCTCTGCAGCCCAGG + Intergenic
901011600 1:6205754-6205776 CCTTGAAGACCCCGCAGCCAAGG + Intronic
901203247 1:7478477-7478499 CCTTAGGGACTGGGCTGCCCAGG + Intronic
905955979 1:41996489-41996511 CCTTTGAGCCACCCCAGCCCAGG - Intronic
907123989 1:52033204-52033226 AGCTGGAGACTCCGCAGCCCCGG + Exonic
909979071 1:82076951-82076973 CCTTAGAGACTTCCCATCTCTGG + Intergenic
910758536 1:90714434-90714456 CCTTAGAGTCTCTGGAGGCCAGG + Intronic
911039819 1:93582808-93582830 CCTCAGCGCCTCCCCAGCCCTGG + Exonic
912737603 1:112164039-112164061 CCTTGGAGAGTGAGCAGCCCAGG + Intergenic
918733947 1:188035500-188035522 CCTTAGACATTCAGCAGACCTGG + Intergenic
920343064 1:205287716-205287738 CCTCAGCAACTCCCCAGCCCTGG - Intergenic
923561546 1:235045702-235045724 CCTTAGAGCCCACACAGCCCTGG + Intergenic
1062956577 10:1544241-1544263 CCCTGGAAACTCAGCAGCCCTGG - Intronic
1065201666 10:23318306-23318328 CCTTTGAGTCACCCCAGCCCAGG - Exonic
1066994251 10:42549444-42549466 CCTTAGAGACTGGGCAGAACTGG - Intergenic
1070324234 10:75377444-75377466 CCTGAAAAACTCCCCAGCCCAGG - Intergenic
1070823934 10:79380070-79380092 CCTTTGAGACCACCCAGCCCTGG + Intergenic
1072621768 10:97084353-97084375 CCTTTGTGGCTCTGCAGCCCAGG - Intronic
1075015443 10:118907286-118907308 CCCTAGGGACTCCGAAGACCAGG + Intergenic
1075518811 10:123131778-123131800 CCTTAGAAAATACACAGCCCTGG - Intergenic
1076496798 10:130902978-130903000 CCTTAGAGAGGCCACAGCCTTGG + Intergenic
1079460135 11:20671148-20671170 CCTTGGCGTCTCCGCAGCCTGGG - Intronic
1080677356 11:34439983-34440005 CCTCTGAGACTCTGCAGCCGTGG - Intronic
1085631415 11:78120249-78120271 CCTTAAAGGCCCCGCAGCTCAGG + Intronic
1088913625 11:114210722-114210744 CCTTAGAGACATCCCAGGCCTGG + Intronic
1090658898 11:128866940-128866962 CCTGGGTCACTCCGCAGCCCTGG - Intronic
1091298617 11:134490391-134490413 ACACAGAGGCTCCGCAGCCCTGG - Intergenic
1091973580 12:4808615-4808637 CCTCAGAGATACCTCAGCCCAGG - Intronic
1091985641 12:4908911-4908933 CCTTAGAGACTCCGCAGCCCTGG + Intergenic
1096963835 12:55608343-55608365 CCTCAGAGATTCACCAGCCCAGG - Intergenic
1101661872 12:106773745-106773767 CCTAAGAGAGTCTGGAGCCCCGG + Intronic
1104335610 12:127892004-127892026 CATTAGAGACTCAGCACCCAAGG - Intergenic
1105579468 13:21680969-21680991 CCTTAGAGTCCCAGCATCCCTGG - Intronic
1105816990 13:24045050-24045072 TCTTACAAACTCCGCCGCCCTGG - Intronic
1113891912 13:113740413-113740435 CCTTAGTGACACTGCAGCCGGGG + Intergenic
1118749267 14:68794610-68794632 TCTTAGCCACTCCGCAGCACCGG - Intronic
1118769106 14:68929738-68929760 CCTCAGAGACTCTGCAGGGCCGG - Intronic
1121109501 14:91303142-91303164 CCTGACAGACTCCCCAGGCCTGG + Intronic
1130652808 15:85771917-85771939 CCTGAGAGACTGCGCTGACCGGG + Intronic
1130888256 15:88111582-88111604 CCTTAGGGAGTCCCCATCCCAGG - Intronic
1134011552 16:10857246-10857268 TTTTAGAGACTCTGCTGCCCAGG - Intergenic
1135572304 16:23558107-23558129 CCCTGGGGACCCCGCAGCCCAGG + Exonic
1136267897 16:29131675-29131697 CCTTCCTGGCTCCGCAGCCCGGG - Intergenic
1137295740 16:47091781-47091803 CATTAGAGACTCAGCACCCAAGG - Intronic
1138449000 16:57081700-57081722 CCTTTGATAATCCCCAGCCCAGG - Intronic
1139758376 16:69163698-69163720 CCTAATATATTCCGCAGCCCAGG - Intronic
1141045757 16:80714966-80714988 CCTTAGTGACTCCACAGCTCTGG - Intronic
1141138603 16:81482740-81482762 CCCCAGTGACTCCGAAGCCCGGG - Intronic
1141754718 16:85983447-85983469 CCTTAGAGCCTCCCCACCCTCGG - Intergenic
1142027025 16:87819907-87819929 CCTTAGAGACTGAGCAGCCAGGG + Intergenic
1142071203 16:88092022-88092044 CCTTCCTGGCTCCGCAGCCCGGG - Intronic
1142148995 16:88504526-88504548 GCTTTCAGACTCCTCAGCCCTGG + Intronic
1142173790 16:88635709-88635731 CCCCAGAGACTCCGGAGCCAGGG + Intergenic
1142825059 17:2505581-2505603 CCTTAGAGACTACATTGCCCAGG + Intronic
1144638845 17:16926734-16926756 CCTTGGAGAATCCCCATCCCAGG + Intergenic
1144728329 17:17512753-17512775 CCTTAGAGAGTAGCCAGCCCAGG + Intronic
1146569994 17:33944302-33944324 CCTATGAGACTACCCAGCCCTGG + Intronic
1147252658 17:39162676-39162698 CCTTGGAGACCCTTCAGCCCTGG + Intronic
1148611616 17:48968434-48968456 CCTGAGATGCTCAGCAGCCCTGG - Intronic
1151747250 17:76018174-76018196 CCGAAGAGACTCCACAGCACTGG + Exonic
1151872413 17:76845251-76845273 CCTTAGAGACTCAGAACCCAAGG + Intergenic
1159332684 18:67019375-67019397 CCTTCCAGACTCCGCTGCACGGG + Intergenic
1159907863 18:74114200-74114222 CATTAGAGACTCAGCACCCCGGG - Intronic
1161303994 19:3557048-3557070 CCTCCGAGACTCCGCGACCCGGG - Intronic
1161417672 19:4156831-4156853 CGTTTGAGCCTCAGCAGCCCCGG + Intronic
1161456195 19:4370795-4370817 CCATAGTGACTTCTCAGCCCTGG - Intronic
1165123835 19:33580437-33580459 CCTCCGAGTCACCGCAGCCCTGG + Intergenic
1166124068 19:40703314-40703336 CCTTAGAGAGACGGGAGCCCAGG - Intronic
1166718823 19:44985983-44986005 GCTTAGAGATTCCGCCACCCAGG - Intronic
1168282768 19:55314381-55314403 TTTTAGAGAATCCTCAGCCCTGG + Intronic
1168514104 19:56996313-56996335 CTTTAGAGACTCAGGAGGCCGGG - Intergenic
1168547214 19:57263418-57263440 CCTGAGAGACTGCCCATCCCAGG + Intergenic
925619206 2:5774354-5774376 CTTTGGAGACTCCTCACCCCAGG - Intergenic
925904420 2:8530983-8531005 CTTTAGAAACTCACCAGCCCAGG - Intergenic
932480727 2:72037476-72037498 CCCTGGAGCATCCGCAGCCCCGG - Intergenic
932591128 2:73068432-73068454 CCTTAGAGACACCCCAACTCTGG + Intronic
937031755 2:118746509-118746531 CTTTAGTGTCTACGCAGCCCTGG - Intergenic
937122266 2:119448998-119449020 CCTTAGAGCTTCTGCAGCCCAGG - Intronic
937895598 2:126974776-126974798 CCCCACAGACTCCACAGCCCTGG + Intergenic
944399100 2:199304871-199304893 CCCCAGAGACTCACCAGCCCTGG - Intronic
948791067 2:240377049-240377071 CCTCAGAGACTCCGAGCCCCTGG - Intergenic
1168869128 20:1113989-1114011 CCTTAGAAAGTCCGTAACCCAGG - Intronic
1175983423 20:62752718-62752740 CCTGTGAGTCACCGCAGCCCGGG - Intronic
1176062739 20:63179333-63179355 CACGTGAGACTCCGCAGCCCAGG + Intergenic
1176194788 20:63831903-63831925 CCTTCCAGACCCCGCACCCCGGG - Intergenic
1177373920 21:20242569-20242591 GCTTAGAGATTCCTCAGGCCTGG - Intergenic
1179450532 21:41465636-41465658 TCTTAGAGCCTTAGCAGCCCTGG - Exonic
1179945352 21:44670525-44670547 CCACAGAGACTCCCCAGTCCAGG + Intronic
1184109493 22:42386785-42386807 CCTTAGCCACTGTGCAGCCCTGG - Intronic
1184379878 22:44138532-44138554 CGTCAGAGCCTCCGCAGCCACGG - Intronic
954743208 3:52770994-52771016 CCAGAGAGGTTCCGCAGCCCCGG + Intergenic
960669171 3:120140272-120140294 CCTGAGAGCGCCCGCAGCCCGGG - Intergenic
962312031 3:134333624-134333646 CTTTAGGGAGCCCGCAGCCCAGG + Intergenic
968433748 4:574926-574948 CCTGCGAGACGCCGCGGCCCTGG - Intergenic
968679360 4:1905952-1905974 CCTTCAAGCCTCTGCAGCCCGGG + Intronic
974115710 4:57576623-57576645 CCTTAGAGAGTACCCAGACCAGG - Intergenic
992844920 5:80736727-80736749 CATTAGAGACTCAGCACCCATGG - Intronic
994897131 5:105721098-105721120 GTGTAGAGACTCCGCAGTCCTGG + Intergenic
1001084591 5:168691548-168691570 CCTTAAAGACTCATCAGCACAGG + Intronic
1004962410 6:20805052-20805074 CATTAGAGACTCAGAATCCCAGG - Intronic
1007454663 6:41967234-41967256 CCTTGGTGACTCTGCTGCCCTGG - Intronic
1007508001 6:42351879-42351901 CCTGAGTGATTCAGCAGCCCAGG - Intronic
1008786502 6:55174861-55174883 CTTTAGAGCCTTCTCAGCCCGGG - Intronic
1017703325 6:157096686-157096708 CCTCAGGGACCCCGCAGCTCAGG - Intronic
1019523855 7:1472083-1472105 CCTTAGAAACTCAGGGGCCCAGG - Intronic
1022100553 7:27166694-27166716 CCTAAGAGACCCCGCAGCTCCGG + Intronic
1023031134 7:36091487-36091509 GCTTAGAGACTTCCCTGCCCAGG + Intergenic
1027713101 7:81632472-81632494 CCTTTGAGTCTTCCCAGCCCAGG - Intergenic
1032020323 7:128404225-128404247 CCTGTGTGACTCAGCAGCCCAGG - Intronic
1033624500 7:143095674-143095696 CCTGGGAGACTCCTCAGCTCTGG - Intergenic
1034218301 7:149424178-149424200 CCTTGGAGACCCCTCAGCGCAGG + Intergenic
1035071504 7:156148302-156148324 CCTTATAGTGTCCACAGCCCAGG - Intergenic
1036478881 8:9120259-9120281 CCTTAAAGAGTGCGCAGGCCAGG + Intergenic
1037613268 8:20494678-20494700 CCCTTGAGACACCTCAGCCCAGG + Intergenic
1039895332 8:41713095-41713117 GCTTAGGGCCTCCGCAGCCCAGG - Intronic
1042403334 8:68374624-68374646 ACTTAGAGACTCTGTAGCACTGG - Intronic
1043873775 8:85463629-85463651 GCGTAGAGGCTCCGCGGCCCGGG + Intergenic
1047982743 8:130199793-130199815 CCTCAGAGACAGGGCAGCCCTGG + Intronic
1048432641 8:134384524-134384546 CCTGAGAGACTGCTCAGTCCTGG - Intergenic
1051710560 9:19926867-19926889 TCTTCCAGACTCTGCAGCCCTGG - Intergenic
1059362457 9:113755677-113755699 CTTGTGTGACTCCGCAGCCCAGG + Intergenic
1061489717 9:130938407-130938429 CCTTCGAGGCTCCGGAGGCCCGG - Intronic
1187245944 X:17553050-17553072 CCTGGGAGACTCCCCAGTCCTGG + Intronic
1189720014 X:43906242-43906264 CCTTAAATTCTCCACAGCCCAGG + Intergenic
1201020163 Y:9647904-9647926 CCTGAAAAACTCAGCAGCCCTGG - Intergenic