ID: 1091987067

View in Genome Browser
Species Human (GRCh38)
Location 12:4919228-4919250
Sequence CACTGCTGTTGGGGTGTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091987067_1091987073 7 Left 1091987067 12:4919228-4919250 CCCAAGACACCCCAACAGCAGTG 0: 1
1: 0
2: 1
3: 15
4: 185
Right 1091987073 12:4919258-4919280 CTCAAAGCTCAGCCTTAGAATGG 0: 1
1: 0
2: 0
3: 9
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091987067 Original CRISPR CACTGCTGTTGGGGTGTCTT GGG (reversed) Intronic
900016385 1:153236-153258 CCCTGCTGTTTGGGTGTTTATGG - Intergenic
900046647 1:511828-511850 CCCTGCTGTTTGGGTGTTTATGG - Intergenic
900068852 1:753545-753567 CCCTGCTGTTTGGGTGTTTATGG - Intergenic
901586413 1:10297655-10297677 CTCTGCTCTTGGGCTGACTTTGG + Intronic
902458813 1:16555354-16555376 CAAGGCTGTTGGGGTCTCTCAGG - Intergenic
902493343 1:16852562-16852584 CAAGGCTGTTGGGGTCTCTCAGG + Intronic
903362105 1:22783326-22783348 CTCTGCTGTTGGGGCTCCTTTGG + Intronic
904684024 1:32247923-32247945 CACTGGTGTTGGGGGGTGTGGGG + Intronic
904710846 1:32428878-32428900 AACTGCTGTTAGGGAGTGTTGGG - Intergenic
905927967 1:41765470-41765492 CCCTGTTGTTTGAGTGTCTTTGG + Intronic
906578797 1:46917290-46917312 CACTGCTTTTGCTGTATCTTAGG + Intergenic
906594752 1:47065514-47065536 CACTGCTTTTGCTGTATCTTAGG - Intergenic
906636717 1:47415349-47415371 CACTGGGGATGGGGGGTCTTTGG - Intergenic
907502836 1:54895239-54895261 TATTGCTGTGGGGATGTCTTAGG + Intergenic
909733540 1:78927658-78927680 CACTGCATTTGGGGAGTTTTAGG - Intronic
911214024 1:95172527-95172549 GCCTGCTGTTGCTGTGTCTTTGG + Intronic
914938812 1:152004007-152004029 AGCTGCTGGTGGGGTTTCTTAGG + Intergenic
915116623 1:153605432-153605454 AACTGCTGTTAGGGAGTTTTGGG - Intergenic
916379060 1:164188547-164188569 CACAGCTGTTGAGGTGCCTTTGG - Intergenic
916835576 1:168541646-168541668 CACTGGAGTTGGGGGATCTTAGG - Intronic
916839030 1:168580502-168580524 CACTGGAGTTGGGGGATCTTAGG + Intronic
917367362 1:174247355-174247377 AACTGCTGTTAGGGGGTTTTGGG - Intronic
918749378 1:188252995-188253017 CATTGCTATTGGGTTGTCATTGG + Intergenic
919328555 1:196139420-196139442 AACTGCTGTTAGGGGGTTTTAGG + Intergenic
921156845 1:212445654-212445676 CACTGCTGTGGGGGGGGCGTGGG - Intronic
923114172 1:230918953-230918975 AACTGCTGTTGGCATGTTTTGGG + Intronic
923473210 1:234310380-234310402 CACTGCTGTTTGGGTAACTTAGG - Intronic
924278292 1:242410098-242410120 AACTGCTGTTAGGGGGTTTTGGG + Intronic
1067432237 10:46252180-46252202 CACTGCTGCTGTGTTGTGTTTGG - Intergenic
1072346545 10:94513343-94513365 CACTGCTGTCTGGGAGTCCTGGG - Intronic
1073949272 10:108787262-108787284 AACTGCTGTTAGGGGGTTTTGGG - Intergenic
1074186042 10:111100242-111100264 CTCTGCTGTTGGAGTGATTTGGG + Intergenic
1074261589 10:111859041-111859063 CTTTGCTATTGGGGTGTCATTGG + Intergenic
1076139004 10:128064812-128064834 CACTTCTGTTGTGGTTTCCTTGG + Intronic
1076344427 10:129770775-129770797 CACAGCTGCTGGGATGTCCTCGG + Intergenic
1076972976 11:148305-148327 CCCTGCTGTTTGGGTGTTTATGG - Intergenic
1077167983 11:1152336-1152358 CACACCTGTGGGGGTGTCTAAGG + Intergenic
1080154000 11:29086716-29086738 CACTGCTGTTATGGTATCATTGG - Intergenic
1080726905 11:34907092-34907114 AACTGCTGTTAGGGGGTTTTGGG - Intronic
1080778762 11:35410949-35410971 CACTGGGGTTGAGGTGTCATTGG - Intronic
1082258685 11:50060958-50060980 CACTGCTGAAGGGCTGTCTTGGG + Intergenic
1082679512 11:56151537-56151559 TACTGCTATGGGGATGTCTTAGG + Intergenic
1091987067 12:4919228-4919250 CACTGCTGTTGGGGTGTCTTGGG - Intronic
1093405248 12:18797054-18797076 CAAAGCTGTTGGGGAGTCCTTGG - Intergenic
1095573134 12:43705221-43705243 GACTGCTGTTAGGGGGTTTTGGG - Intergenic
1096317661 12:50582653-50582675 CACTGCTGTTGGTGGGTGATGGG - Intronic
1098768209 12:74516979-74517001 CATTCCTATTGAGGTGTCTTTGG - Intergenic
1098994942 12:77108357-77108379 CACTGCTTCTGTGGTGCCTTTGG + Intergenic
1100025439 12:90122324-90122346 CACTGCTGCTGGGGTGGGTTTGG + Intergenic
1101383063 12:104231227-104231249 AACTGCTGTTAGGGGGTTTTGGG + Intronic
1108242284 13:48478037-48478059 AACTACTATTGGGTTGTCTTAGG + Intronic
1109368387 13:61388682-61388704 CAAAGCTGTTGGGATGTCCTTGG - Intergenic
1111201158 13:84939187-84939209 CATTGTTGTTTGTGTGTCTTGGG + Intergenic
1115346825 14:32352043-32352065 CACTGCTTTTGTGTAGTCTTGGG + Intronic
1117301087 14:54429197-54429219 CACTGCTGTAGGTGTGTTGTAGG - Intronic
1122699570 14:103578834-103578856 CACTGCTGTTAGGGTGACCACGG - Intronic
1124049823 15:26186652-26186674 CACTGATGTTGGTGTGTGTGGGG + Intergenic
1125677129 15:41508171-41508193 GACTGCAGTTGAGGTGCCTTCGG + Exonic
1126337762 15:47605550-47605572 AACTGCAGATGGGGTGTCTTAGG + Intronic
1126575063 15:50188417-50188439 CACTGCTGTTGGCCATTCTTTGG - Intronic
1126846748 15:52767132-52767154 TTTTGCTGTTGGGGTGACTTGGG - Intronic
1130535097 15:84778704-84778726 AACTGCTGTTAGGGGGTTTTGGG + Intronic
1134659281 16:15971572-15971594 AACTGCTGTTAGGGGGTTTTGGG + Intronic
1136989887 16:35145608-35145630 CACCGGGGTTGGGGTGTCGTTGG + Intergenic
1138653683 16:58477240-58477262 CATTGCTACTGGGGTGTCATTGG - Intronic
1139905964 16:70366288-70366310 CACTGCAGATGGGGAGTCTGAGG - Intronic
1142447276 16:90149221-90149243 CCCTGCTGTTTGGGTGTTTATGG + Intergenic
1142460217 17:86110-86132 CCCTGCTGTTTGGGTGTTTATGG - Intergenic
1144583471 17:16473612-16473634 AACTGCTGGTGGGGGGTCATTGG + Intronic
1147125487 17:38365089-38365111 CACTGCTATTGGGCTGCATTAGG + Intronic
1147969741 17:44212862-44212884 CACAGCTGCTGGGGGGTTTTGGG + Exonic
1148014488 17:44511632-44511654 AACTGCTGTTAGGGGGTTTTGGG - Intergenic
1151377066 17:73697159-73697181 CACTGGGCTTGGGGGGTCTTTGG + Intergenic
1151833618 17:76569646-76569668 CATTGGTGTTGGGGAGGCTTAGG + Intronic
1151886528 17:76926105-76926127 CACTGCCCATGGGCTGTCTTTGG - Intronic
1152470097 17:80486373-80486395 CCCTCCTTTTGGGATGTCTTGGG + Intergenic
1155716052 18:28945253-28945275 CCCTGCTATTGGGGAGTCTAAGG - Intergenic
1156279910 18:35627099-35627121 CAGTGCTGTGTAGGTGTCTTTGG + Intronic
1157662065 18:49454178-49454200 AACTGCTGTTAGGGGGTGTTGGG - Intronic
1157755790 18:50216354-50216376 CACTGCTGCTTGGGTTTTTTTGG - Intergenic
1159063373 18:63540590-63540612 CACTGCTGGTGGGATTTCTCTGG + Intergenic
1159123383 18:64195673-64195695 AAAAGCTGTTGGGGTGACTTGGG - Intergenic
1159794895 18:72830219-72830241 CACTGCTGTTCCCGTCTCTTGGG - Intronic
1160649932 19:218610-218632 CCCTGCTGTTTGGGTGTTTATGG - Intergenic
1160987144 19:1844299-1844321 CACTGCTGTTTGGGGGTCACAGG + Intronic
1161186130 19:2922027-2922049 CACTGCTGATGGCTTGTGTTTGG + Intergenic
1163662483 19:18587135-18587157 AACTGCTGTTGGGGTGTGGGAGG - Intronic
1165937788 19:39399694-39399716 CACTGCTGGTGGGCTCTGTTGGG - Exonic
1166767915 19:45263348-45263370 CACCGATGTTGGGGTGGTTTAGG - Exonic
925705013 2:6676501-6676523 CCCTGCAGTTGAGGTGTCCTAGG - Intergenic
927812236 2:26186511-26186533 CACTGCTGTCTGGGTGTCTTGGG + Intronic
938243295 2:129759275-129759297 CGCTGCTGATGGGGTGTGTGGGG - Intergenic
944608670 2:201377399-201377421 CACTGCTGTTGGGTTGCATGTGG + Exonic
945963077 2:216156351-216156373 TTCTGCTGTTGTGGGGTCTTTGG + Intronic
947103957 2:226649171-226649193 TTCTGCTGTTTGGGTGTGTTCGG - Intergenic
947826895 2:233112580-233112602 CATTGCTGTTGGAGTGTTGTGGG + Intronic
948873479 2:240815534-240815556 CTCAGGGGTTGGGGTGTCTTTGG - Intronic
1170892279 20:20386297-20386319 CACTGCTGTTTGTGTGTGTTGGG + Intergenic
1171038711 20:21739793-21739815 CAGTGCTGTTGGGGTGTGGCGGG - Intergenic
1171122804 20:22580611-22580633 CCCTGTTGTTGTGGTCTCTTGGG - Intergenic
1171323996 20:24274764-24274786 AACTGATGTGGGTGTGTCTTGGG + Intergenic
1173034597 20:39396358-39396380 CACTGTTTTTGGGGTTGCTTAGG + Intergenic
1174113815 20:48213742-48213764 CAAGGCTGCTGGGGAGTCTTGGG + Intergenic
1175712670 20:61233261-61233283 CTGTGCTGTTGGGGTGTGTCTGG - Intergenic
1181450166 22:23014443-23014465 CAATGCTGTTGGGTTGTGTTTGG - Intergenic
1185144242 22:49121338-49121360 CACTGCTGCAGGGGTTTCCTGGG + Intergenic
949697792 3:6719457-6719479 CACTGCTTCTGGGGTGTTATTGG - Intergenic
949736662 3:7180394-7180416 GATTGCTGTTTGGGTGTGTTAGG - Intronic
950004780 3:9684697-9684719 CTCTGCTCTTTGGGTGTGTTAGG + Intronic
952968895 3:38638240-38638262 CCCTGCAGTTGGGGTGACCTCGG + Intronic
952976596 3:38701785-38701807 CACCTCTGTTTGGGGGTCTTTGG - Intronic
953135091 3:40175396-40175418 CATTGCTGTTGGGGTATCTGTGG - Intronic
954995811 3:54880619-54880641 CACTGGTGTTGGTTTTTCTTAGG - Intronic
958108073 3:89103759-89103781 CCCTGCTACTGGGGTGTCTGAGG - Intergenic
961509036 3:127390088-127390110 GCCTGCTGATGGGGTGTCTCTGG - Intergenic
963057147 3:141194767-141194789 CTTTGCTGTTTGGGTGACTTAGG + Intergenic
965167146 3:165209591-165209613 CACTGCTGTTGCGGGGTCAGGGG - Intergenic
967539421 3:190648280-190648302 CAATGCTTTTGGGGAGTTTTTGG + Intronic
968367914 3:198201519-198201541 CCCTGCTGTTTGGGTGTTTATGG + Intergenic
971955604 4:33414196-33414218 AACTGGTGTTGGGTTTTCTTTGG + Intergenic
974898056 4:67963284-67963306 GACTGCTAGTGAGGTGTCTTTGG - Intronic
975730212 4:77330278-77330300 AACTGCTGTTAGGGGGTTTTGGG + Intronic
977752063 4:100621182-100621204 AACTGCTGTTAGGGGGTTTTGGG + Intronic
978437037 4:108696694-108696716 AACAACTGTTGGGATGTCTTGGG + Intergenic
978498935 4:109387669-109387691 AACTGCTGTTAGGGGGTTTTGGG + Intergenic
980462928 4:133140574-133140596 CAATGCTTTTGGTATGTCTTAGG - Intergenic
981516741 4:145618684-145618706 CACTGCTGCAGGGGTGTCCTCGG - Exonic
983753015 4:171299400-171299422 CACTGATGTTCGGATGTGTTCGG - Intergenic
988299004 5:29397576-29397598 CACTGGAGTTTGGGTGTTTTTGG - Intergenic
988856709 5:35234118-35234140 AACTGCTGTTAGGGGGTTTTGGG + Intergenic
989103133 5:37838742-37838764 CAGTGGTGGTGGGGTGTTTTTGG + Intronic
989281968 5:39654929-39654951 AACTGCTGTTAGGGGGTATTGGG - Intergenic
992767922 5:80019635-80019657 CACTGCTGTTGGTACTTCTTGGG - Intronic
993858332 5:93102848-93102870 CACTCCTGTGGGGATTTCTTGGG - Intergenic
995234068 5:109806056-109806078 CACTGCAGGTGGGGAGGCTTTGG + Intronic
995610214 5:113901652-113901674 CACTGGTTTTGGAGTGACTTAGG - Intergenic
996302817 5:122008239-122008261 CACTGATGTTGGCCTGTCTTGGG + Intronic
1002727133 5:181306748-181306770 CCCTGCTGTTTGGGTGTTTATGG + Intergenic
1003374536 6:5563543-5563565 AACTGCTGTTAGGGGGTTTTGGG + Intronic
1006104447 6:31708024-31708046 CCCTGCTCTTGGTGTGTCCTGGG + Exonic
1007077604 6:39078000-39078022 CGCTGCTGTTTGTGTGTCTGTGG + Intronic
1007421618 6:41723273-41723295 CACTGGCATTGGGATGTCTTTGG - Intronic
1008384527 6:50873312-50873334 CACTGTGGTTGGCTTGTCTTGGG - Intergenic
1008561794 6:52731563-52731585 AACTGCTGTTAGGGGGTTTTGGG - Intergenic
1010691447 6:78915614-78915636 CAAGGCTGTTGGGGAGTCCTTGG - Intronic
1012932174 6:105328766-105328788 GACTGGTGTTTGGGTTTCTTTGG - Intronic
1014199078 6:118588914-118588936 AACTGCTGTTAGGGGGTTTTGGG - Intronic
1014802301 6:125790820-125790842 CGCCGCAGTCGGGGTGTCTTAGG - Exonic
1015393877 6:132713904-132713926 CACTGGTGTTAGGGTGGCATTGG + Exonic
1016114935 6:140269272-140269294 TATTGCTGTTGCGGTGTCTCTGG - Intergenic
1017619430 6:156280674-156280696 CACTTCTGTTTGTCTGTCTTTGG - Intergenic
1019633271 7:2061570-2061592 CACTCCTGTTGGGGTGTGGATGG - Intronic
1022607066 7:31825798-31825820 CTTTGTTGTTGGAGTGTCTTTGG - Intronic
1022691245 7:32657337-32657359 CAGTGCTGCTGGGATATCTTAGG + Intergenic
1022918808 7:34991245-34991267 CAGTGCTGCTGGGATATCTTAGG + Intronic
1023725584 7:43139861-43139883 CATTACTGTCTGGGTGTCTTAGG + Intronic
1024621531 7:51162025-51162047 CACTGCTGTTTGTGTGACTTAGG + Intronic
1026221268 7:68399670-68399692 CAGTGCTCTTGGGATGTCATTGG + Intergenic
1029488338 7:100856809-100856831 CCCGGCTGGTGGGGTGCCTTAGG + Intronic
1035239546 7:157520880-157520902 CATGGCTGTTGGGGTATCTGAGG - Intergenic
1035365569 7:158347944-158347966 CTCTGCTGTTGTGGTATCCTAGG + Intronic
1036143206 8:6227163-6227185 CACTCCTGTTGGGGAGACTTGGG - Intergenic
1037056977 8:14455057-14455079 GACTGCTCTTGTGGTGTTTTTGG - Intronic
1040449360 8:47528634-47528656 CACTTCTGTTATGGTGCCTTCGG - Intronic
1040947717 8:52901443-52901465 CACTGCTGGTTGGGTCCCTTGGG - Intergenic
1041782581 8:61593803-61593825 CACTGCTGTTGGTGAGGCTGCGG - Intronic
1042367674 8:67955290-67955312 CAATGCTCATGGGCTGTCTTGGG - Intronic
1047284876 8:123479474-123479496 AACTGCTGTTAGGGGGTTTTGGG - Intergenic
1047627081 8:126667220-126667242 CAATGCTGTTTGGGTCTCTCAGG - Intergenic
1055311341 9:74984849-74984871 CACTTCTGTTGAGGTGCTTTGGG + Intronic
1057735744 9:97658122-97658144 CATTGCCATTGGGGTGTCATTGG + Intronic
1058107450 9:100988785-100988807 CACTGCTGTTGGAGGGTCAATGG - Intergenic
1058153319 9:101486100-101486122 CACTGCGCTCGCGGTGTCTTGGG - Intronic
1059977118 9:119729344-119729366 CACTCCTGTTGGGGTGACTCGGG + Intergenic
1061028273 9:128064642-128064664 CTCTGCTGTTGGGGAGACCTGGG - Intronic
1061145673 9:128796960-128796982 CAATGCTTTTGGGGAGTCTTGGG + Intronic
1061230348 9:129312317-129312339 CACTGTTCTTCGAGTGTCTTTGG - Intergenic
1061277481 9:129577687-129577709 CACTGCTGTGCTGGAGTCTTTGG - Intergenic
1062688811 9:137830367-137830389 CACTGCTGTCAGGGTGCCATGGG + Intronic
1062752255 9:138264224-138264246 CCCTGCTGTTTGGGTGTTTATGG + Intergenic
1185787522 X:2903451-2903473 GGCTGCTGTTGGTGTATCTTTGG - Intergenic
1186740382 X:12511194-12511216 CACTGCTGTTGTTGAGACTTGGG - Intronic
1187896359 X:23983256-23983278 GAATGCTGTTGAGGTTTCTTAGG + Intergenic
1192148567 X:68697894-68697916 TCCTGCTCTTGGGCTGTCTTTGG + Intronic
1192467147 X:71365582-71365604 CCCAGCTGTTGGGGGGTCTGAGG - Intergenic
1192984536 X:76382652-76382674 CACTGCTGTAGCTGTGTCTCAGG - Intergenic
1193353010 X:80483768-80483790 AACTGCTGTTAGGGGGTTTTGGG - Intergenic
1195552129 X:106182724-106182746 CACTGCTGCAGGGGGGTCTGGGG + Intronic
1195920343 X:109977497-109977519 AACTGCTGTTAGGGGGTTTTGGG - Intergenic
1199716759 X:150512286-150512308 CACTTCTGGTGGGGTGGCCTTGG - Exonic
1199811523 X:151354581-151354603 CACTGCTGCTGGGATGTCTGGGG + Intergenic
1199871664 X:151903737-151903759 CACTGTGGTTGTGGTTTCTTGGG + Intergenic
1200684708 Y:6247839-6247861 GGCTGCTGTTGTGGTGTCTGCGG - Exonic
1200990238 Y:9339104-9339126 GGCTGCTGTTGTGGTGTCTGCGG - Exonic
1200992899 Y:9359419-9359441 GGCTGCTGTTGTGGTGTCTGCGG - Exonic
1200995553 Y:9379697-9379719 GGCTGCTGTTGTGGTGTCTGCGG - Intronic
1200998218 Y:9400043-9400065 GGCTGCTGTTGTGGTGTCTGCGG - Exonic
1201000728 Y:9468577-9468599 GGCTGCTGTTGTGGTGTCTGCGG - Intronic
1201003394 Y:9488907-9488929 GGCTGCTGTTGTGGTGTCTGCGG - Exonic
1201006050 Y:9509189-9509211 GGCTGCTGTTGTGGTGTCTGCGG - Intergenic
1201008708 Y:9529502-9529524 GGCTGCTGTTGTGGTGTCTGCGG - Exonic
1201900387 Y:19042285-19042307 AACTGCTGTTAGGGTGTTTAGGG - Intergenic