ID: 1091989147

View in Genome Browser
Species Human (GRCh38)
Location 12:4940700-4940722
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091989147 Original CRISPR AACTTCTTCTAGGAGCACAA AGG Intergenic
No off target data available for this crispr