ID: 1091992049

View in Genome Browser
Species Human (GRCh38)
Location 12:4963379-4963401
Sequence CTGGTCATGAGGATGTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091992049_1091992054 17 Left 1091992049 12:4963379-4963401 CCAGGACACATCCTCATGACCAG No data
Right 1091992054 12:4963419-4963441 AAATTCCCAGCCTGTTTGGAAGG No data
1091992049_1091992053 13 Left 1091992049 12:4963379-4963401 CCAGGACACATCCTCATGACCAG No data
Right 1091992053 12:4963415-4963437 CGTGAAATTCCCAGCCTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091992049 Original CRISPR CTGGTCATGAGGATGTGTCC TGG (reversed) Intergenic
No off target data available for this crispr