ID: 1091996498

View in Genome Browser
Species Human (GRCh38)
Location 12:4997927-4997949
Sequence CGCCCCGAAGCAGAAGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091996498_1091996500 -4 Left 1091996498 12:4997927-4997949 CCTGAGCCTTCTGCTTCGGGGCG No data
Right 1091996500 12:4997946-4997968 GGCGCTAATCTTACTTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091996498 Original CRISPR CGCCCCGAAGCAGAAGGCTC AGG (reversed) Intergenic
No off target data available for this crispr