ID: 1091996826

View in Genome Browser
Species Human (GRCh38)
Location 12:5000464-5000486
Sequence CATCGTTACCAGAGAGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091996826_1091996832 -6 Left 1091996826 12:5000464-5000486 CCCTCACCTCTCTGGTAACGATG No data
Right 1091996832 12:5000481-5000503 ACGATGCTCAGGGAATTTCAGGG No data
1091996826_1091996833 12 Left 1091996826 12:5000464-5000486 CCCTCACCTCTCTGGTAACGATG No data
Right 1091996833 12:5000499-5000521 CAGGGTCCACCTTGCTGTCCTGG No data
1091996826_1091996837 25 Left 1091996826 12:5000464-5000486 CCCTCACCTCTCTGGTAACGATG No data
Right 1091996837 12:5000512-5000534 GCTGTCCTGGGACAGAGTCCTGG No data
1091996826_1091996834 13 Left 1091996826 12:5000464-5000486 CCCTCACCTCTCTGGTAACGATG No data
Right 1091996834 12:5000500-5000522 AGGGTCCACCTTGCTGTCCTGGG No data
1091996826_1091996838 28 Left 1091996826 12:5000464-5000486 CCCTCACCTCTCTGGTAACGATG No data
Right 1091996838 12:5000515-5000537 GTCCTGGGACAGAGTCCTGGTGG No data
1091996826_1091996831 -7 Left 1091996826 12:5000464-5000486 CCCTCACCTCTCTGGTAACGATG No data
Right 1091996831 12:5000480-5000502 AACGATGCTCAGGGAATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091996826 Original CRISPR CATCGTTACCAGAGAGGTGA GGG (reversed) Intergenic
No off target data available for this crispr